ID: 1144424862

View in Genome Browser
Species Human (GRCh38)
Location 17:15132311-15132333
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1091
Summary {0: 22, 1: 98, 2: 205, 3: 271, 4: 495}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144424856_1144424862 3 Left 1144424856 17:15132285-15132307 CCTCAATTTGAATTGACCCACCC No data
Right 1144424862 17:15132311-15132333 AATTTGCATGTAATTGAAAGTGG 0: 22
1: 98
2: 205
3: 271
4: 495
1144424854_1144424862 28 Left 1144424854 17:15132260-15132282 CCCATAAAGTTCTAAACAACTTG No data
Right 1144424862 17:15132311-15132333 AATTTGCATGTAATTGAAAGTGG 0: 22
1: 98
2: 205
3: 271
4: 495
1144424855_1144424862 27 Left 1144424855 17:15132261-15132283 CCATAAAGTTCTAAACAACTTGC No data
Right 1144424862 17:15132311-15132333 AATTTGCATGTAATTGAAAGTGG 0: 22
1: 98
2: 205
3: 271
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144424862 Original CRISPR AATTTGCATGTAATTGAAAG TGG Intergenic
900737098 1:4305817-4305839 AATTTGCATGTAACTAACAGTGG - Intergenic
902153398 1:14463079-14463101 AATTTGCATGTAATTAAAAGTGG - Intergenic
902155844 1:14485586-14485608 AATCTGCACGCAATTAAAAGTGG + Intergenic
902259942 1:15217346-15217368 CTTTTGCACATAATTGAAAGTGG + Intronic
902260123 1:15218860-15218882 AATTTGCATGTGACTAAAAGTGG + Intronic
902682749 1:18055196-18055218 GATTACCATGTAATTGAGAGGGG - Intergenic
902714078 1:18260556-18260578 AATTTGCATGTAATTGAAAGTGG - Intronic
902714246 1:18261550-18261572 AATTTGCATGTAATTAAAAGTGG + Intronic
902749067 1:18494083-18494105 AATTTGCATGTAATTAAAAGTGG - Intergenic
902959903 1:19955893-19955915 AATTAGCATGTCATTCAAAGTGG + Intergenic
902966517 1:20008520-20008542 AATTTACATGTGGTTAAAAGTGG - Intergenic
903162698 1:21500719-21500741 AATTTGCATCTAACAGGAAGCGG + Intergenic
903794841 1:25920863-25920885 AATTTGCATGTAATTAAAAGTGG + Intergenic
903824413 1:26132784-26132806 AATTTGCATATAATTAAAAGTGG + Intergenic
904347651 1:29883739-29883761 AATCTGCATGCAGTTAAAAGTGG + Intergenic
904348554 1:29890110-29890132 AATCTGCATGTCATTAAAAGTGG + Intergenic
904407839 1:30305041-30305063 AATTTGCATGTAATTAAAAGTGG + Intergenic
904455987 1:30648439-30648461 AATTTGCATATAATTAAAATTGG - Intergenic
904589297 1:31600639-31600661 CATTTGCATGAAATTCAAAAGGG - Intergenic
904718355 1:32486508-32486530 AATTTGCATGTAACTAAAAGTGG - Exonic
905597883 1:39224212-39224234 ATTTTGCATGTAATTTTAGGTGG + Intronic
906217285 1:44050483-44050505 AATTTGCATGTACTTAAAAGTGG + Intergenic
906218876 1:44061608-44061630 AATTTGCATGTAATTAAAAATGG + Intergenic
906234417 1:44195896-44195918 AATTTGCATGTAATCGAAAGTGG + Intergenic
906499876 1:46333846-46333868 AATTTGCATCTAATTAAAAGTGG + Intergenic
906578280 1:46910860-46910882 AATCTGCATGCAATTAAAAGTGG - Intergenic
906870184 1:49470754-49470776 AATTTGCATACAATTGAAGTGGG + Intronic
907002295 1:50873687-50873709 AATTTGCATGTAATTAAAAGTGG + Intronic
907026415 1:51124609-51124631 AATTTGCATGTAATTGAATGTGG - Intronic
907652645 1:56310458-56310480 AATCTGCATGCAATTAAAAGTGG - Intergenic
908297543 1:62728099-62728121 AATCTGCATACAATTAAAAGTGG - Intergenic
908502174 1:64754662-64754684 AATTTGCATATTATTTCAAGGGG + Intronic
908522177 1:64955090-64955112 AATTTGCAGGAGATTCAAAGTGG - Intronic
908985994 1:70022818-70022840 AATTTACATGAAATTTAAAAAGG + Intronic
909247259 1:73302098-73302120 AACTATCATGTGATTGAAAGAGG - Intergenic
910479048 1:87638598-87638620 AATTTGCATATACTTAAAAATGG + Intergenic
910951204 1:92650162-92650184 AATTCACATGGAATTGCAAGTGG - Intronic
911409803 1:97488841-97488863 AATTTGGATGTAATCAAAAGTGG + Intronic
911454879 1:98110316-98110338 AATTTGCTGTCAATTGAAAGAGG - Intergenic
911732330 1:101304162-101304184 CATTTGCATGTAATTAAAAGTGG + Intergenic
911792093 1:102030259-102030281 AATATGCATGAACCTGAAAGTGG + Intergenic
911937955 1:104004714-104004736 GATTTGCATATAATTAAAAGTGG + Intergenic
912069970 1:105796811-105796833 AATTTGCATGTGATTAAAAATGG - Intergenic
912240308 1:107900325-107900347 AATTTGCATGCAGTGGTAAGGGG - Intronic
912826854 1:112912581-112912603 ACTTTTCAGGTAAGTGAAAGGGG + Exonic
912971402 1:114287047-114287069 ACTTTGCATATAATTGAAAGTGG - Intergenic
913232198 1:116749387-116749409 AATTTGCATATAATTAAAATGGG - Intergenic
913324215 1:117612484-117612506 AATTTGAGTGAAATTGCAAGAGG + Intronic
913373085 1:118122264-118122286 AATTTGCAAATGATTGAAAAGGG + Intronic
913658185 1:120981807-120981829 AATTGGCATGTAATTAAAAGTGG - Intergenic
913693772 1:121304728-121304750 AATTTGATTGCAATTGCAAGTGG - Intronic
914009541 1:143764876-143764898 AATTGGCATGTAATTAAAAGTGG - Intergenic
914143788 1:144975350-144975372 AATTTGATTGCAATTGCAAGTGG + Intronic
914408006 1:147396043-147396065 AATTTGCATATAATTAAAAGTGG - Intergenic
914412503 1:147444625-147444647 AATTTGTATGGAATTGCAAGGGG - Intergenic
914522753 1:148433072-148433094 AATTGGCATGCAATTAAAAGTGG - Intergenic
914648166 1:149673551-149673573 AATTGGCATGTAATTAAAAGTGG - Intergenic
914938367 1:152000575-152000597 AATCTGCATGCAATTAAAAGTGG - Intergenic
914982361 1:152425944-152425966 AATTAGCATGTCATTAAAAGTGG + Intergenic
915259314 1:154664947-154664969 AATTTGCATGTAATTAAAAGTGG + Intergenic
916005801 1:160658940-160658962 AATTTGCATATAATTAGAAGTGG - Intergenic
916443723 1:164852918-164852940 ATTTTCCATGCAATTGAAAAAGG - Intronic
916761627 1:167822729-167822751 AATTTGCACCTAAGTGATAGTGG - Intronic
917205495 1:172566657-172566679 AATTTGCATATAATTAAAAGTGG - Intronic
917539605 1:175899992-175900014 AATTTCAATTTAATTGAATGGGG - Intergenic
917613932 1:176717446-176717468 AATTAGCATATAATTAAAAGTGG + Intronic
918420657 1:184361322-184361344 AATTTGCATGTAATTAAAAGTGG - Intergenic
918682437 1:187372085-187372107 AATTTGCATGTAATTGAAAGTGG + Intergenic
918682498 1:187372731-187372753 AATTTGCATGTAGTTGAAAATGG - Intergenic
918771959 1:188572723-188572745 AACTTTCATGTAGTTGTAAGAGG + Intergenic
918794306 1:188873261-188873283 AACTTGCATGTCATTAAAAGTGG + Intergenic
919139710 1:193555772-193555794 ACTTTGCATATTATTAAAAGTGG + Intergenic
920063420 1:203245847-203245869 AATTTGCATATAATTATAAGTGG - Intronic
920187959 1:204173599-204173621 TATTTGCTAGTAAATGAAAGAGG - Intergenic
920481097 1:206323095-206323117 AATTTGATTGCAATTGCAAGTGG - Intronic
920624150 1:207579651-207579673 AATTTACATGTAACTGAAATGGG + Intronic
920636788 1:207711935-207711957 AATTTACATGTAATTGAAGCGGG + Intronic
921073863 1:211684362-211684384 AATCTGCATGCAGTTAAAAGTGG - Intergenic
921387251 1:214582568-214582590 AGTTTGCATGTAAATTAAAGTGG - Intergenic
921681511 1:218038154-218038176 AATTCACATGTAATTGCAAGGGG + Intergenic
921802403 1:219416589-219416611 AATTTGCATACAATTAAAAGTGG - Intergenic
922459959 1:225808432-225808454 AATCTGCATGTAACTAAAAGTGG - Intergenic
922538499 1:226401409-226401431 AATTTGCATATAATTAAAAGTGG - Intronic
922711058 1:227833185-227833207 AATTTATATGTAATTAGAAGAGG + Intronic
923183793 1:231549962-231549984 CATCTGCATGTCATGGAAAGAGG - Intronic
923202464 1:231725518-231725540 AATTTGCCTGTAATTGAAAGTGG + Intronic
923234949 1:232023584-232023606 AATCTGCACGTAATTTAAAAAGG + Intronic
923459516 1:234196279-234196301 AATTTGCATGTAATTAAAAGTGG + Intronic
923829978 1:237544261-237544283 AATGTGCATGTTAAAGAAAGGGG + Intronic
924279005 1:242417471-242417493 AGTTTGCATGTAATTAAAAGTGG + Intronic
924848179 1:247794266-247794288 AATTTGCATGTAATTGGAAGTGG + Intergenic
1063493511 10:6486498-6486520 AATTTGCATGTAGTTAAAAGTGG + Intronic
1063533847 10:6863415-6863437 AATTTGCATGTATGTAATAGTGG - Intergenic
1063925776 10:10975920-10975942 AATTTGCATGTAATTGAAAGTGG - Intergenic
1063965930 10:11345800-11345822 AATTTGCATGTGATTGAAAGTGG - Intergenic
1063966822 10:11352487-11352509 AATTTGCATGTAATTGAAAGTGG - Intergenic
1064461720 10:15541040-15541062 AAGTTGCATATAATTGAACATGG + Intronic
1064480623 10:15736909-15736931 TATTTGCATGTATTTGAGACAGG - Intergenic
1064647356 10:17473107-17473129 AATTTGCATGTAACTGAAAGTGG + Intergenic
1064689137 10:17895915-17895937 CATTTGCATGTAATTAAAAGTGG - Intronic
1064862761 10:19845742-19845764 GATTTGCATGTAATTAAAAGTGG - Intronic
1065463734 10:25996974-25996996 AATTTTTATATAATTCAAAGTGG + Intronic
1066073994 10:31853679-31853701 AATTTGATTGTAATAGAAAAAGG + Intronic
1066201577 10:33146913-33146935 AATTTGCATTTAATTGTAATCGG + Intergenic
1066312056 10:34206666-34206688 AATTTGCATGTAGTTAAAAGTGG - Intronic
1067153078 10:43752349-43752371 AATATGTATGTAAATGAAAATGG - Intergenic
1068086475 10:52379730-52379752 AATATGCATGTAACTGAAAGTGG - Intergenic
1068378612 10:56216960-56216982 AATTTGCATATAATTAAAAGTGG + Intergenic
1068657267 10:59588559-59588581 AATTTGTGTGTAATTGAAAGTGG - Intergenic
1068691505 10:59920446-59920468 AATTTGCATATAATTAAAAGTGG - Intergenic
1069048181 10:63764874-63764896 AATCTGCATGCAATTAAAAGTGG - Intergenic
1069163875 10:65124765-65124787 ACATTGCCTGTAATTGAGAGTGG - Intergenic
1069265783 10:66455627-66455649 AACATGCATGTAATTAAAAGTGG + Intronic
1070184886 10:74052005-74052027 AATTAGAATATAATTAAAAGTGG - Intronic
1070196300 10:74160331-74160353 AATTTGTATATAATTAAAATTGG + Intronic
1070205323 10:74253280-74253302 AATCTGCATGTTATTAAAAAAGG - Intronic
1070580259 10:77713750-77713772 AACTTGCATGCATTTGGAAGAGG - Intergenic
1071436115 10:85649459-85649481 AATTTGCCTGTAATGAAAGGAGG + Intronic
1071913665 10:90265682-90265704 CATTTGCAGGAAATTGAAACTGG + Intergenic
1071914354 10:90274906-90274928 AATTTGAAGCTAATTGAATGTGG - Intergenic
1071946551 10:90652292-90652314 AATTTGCATATAATTAAAAGTGG + Intergenic
1072264287 10:93712696-93712718 AATTTGCATGTAATTAAAAGTGG + Intergenic
1072397226 10:95057033-95057055 AATATGCATGCAATTAAAAGTGG - Intronic
1072526854 10:96279435-96279457 AATTTGCATCTAATTAAAAGTGG + Intergenic
1072871190 10:99122742-99122764 AATTTGAATGTAATTCCAAATGG + Intronic
1072887881 10:99296463-99296485 AATCTACATGCAATTAAAAGTGG + Intergenic
1072888953 10:99304331-99304353 AATCTGCATGCAATTAAAAGTGG + Intergenic
1073127229 10:101158917-101158939 AATTTGCATATAGTTAAAAGCGG + Intergenic
1073793324 10:106961796-106961818 AATTTGCAAGTTATTAAAAGTGG + Intronic
1073893392 10:108125273-108125295 AATTCACATATAATTAAAAGTGG - Intergenic
1073936116 10:108634380-108634402 AATTAGCATGTTATTAAAAGTGG - Intergenic
1074344546 10:112670611-112670633 AATTTGCAAGTCATTTAGAGAGG + Intronic
1074390759 10:113056363-113056385 AATTTGAATCTAATTGGAAGTGG + Intronic
1074504012 10:114051323-114051345 AATTTGCAAATAGTTGAAGGTGG - Intergenic
1074575805 10:114668082-114668104 AGGTTGCATGAAATTGAAAGGGG + Intronic
1074684926 10:115952446-115952468 AATTTGCATTTAATTTTTAGTGG - Intergenic
1074739490 10:116471076-116471098 TATTTGAAAATAATTGAAAGGGG - Intronic
1074924198 10:118050355-118050377 AAATTGCATGTATGTGCAAGTGG + Intergenic
1075294225 10:121259470-121259492 AATTTACATGTAATTAAAAATGG - Intergenic
1075363632 10:121862924-121862946 AATTTGCATGCAATTAAAGGGGG + Intronic
1076040770 10:127246334-127246356 AATTTGTGTGTGATTGAAAGAGG + Intronic
1076083910 10:127608096-127608118 AATTAGCATGTAATTAAAAATGG - Intergenic
1076430401 10:130398128-130398150 ACTTTCCATGTATTTGAAACAGG + Intergenic
1076660671 10:132054150-132054172 ACTTTGCATGAACTTGGAAGAGG + Intergenic
1076824988 10:132962425-132962447 AATCTGCATGCGATTAAAAGCGG + Intergenic
1077039520 11:513005-513027 AATCTACATGAAATTAAAAGTGG + Intergenic
1077558835 11:3243010-3243032 AACTCACATGTAATTAAAAGTGG + Intergenic
1077983106 11:7321736-7321758 AATTTGTATGTAATTGGAAGTGG - Intronic
1078409877 11:11105657-11105679 AATCTGTATGCAATTAAAAGTGG + Intergenic
1078499503 11:11856338-11856360 AATTTGCATACAAATCAAAGTGG + Intronic
1078982569 11:16553341-16553363 AATTTGCATATAATTGAAAGTGG - Intronic
1079064021 11:17274246-17274268 AATTTGCATATACTTAAAAGTGG + Intronic
1079783669 11:24642746-24642768 ACTCTGCATGTAAGAGAAAGTGG + Intronic
1079854661 11:25586967-25586989 AATTCTCATGTAGTTGTAAGGGG + Intergenic
1080216886 11:29853684-29853706 AATTTTCATGTAATTGTGTGGGG - Intergenic
1080650288 11:34217038-34217060 AATTTGCATATAATTAAAAGTGG + Intronic
1081004539 11:37718639-37718661 AATTAGCATGTAATTAAAGTTGG - Intergenic
1081842714 11:46214901-46214923 AATTTGTATATAATTAAAAGTGG + Intergenic
1082679838 11:56153709-56153731 AATTTGCATGCAATGGAATTAGG - Intergenic
1082717898 11:56637881-56637903 AATTTGCATGTAACTTATACTGG - Intergenic
1082827870 11:57594012-57594034 AATCTGCATGTAATGGAAAGTGG + Intergenic
1082898515 11:58219556-58219578 AATTAGCATTAAATTGAAAGTGG + Intergenic
1083116896 11:60469325-60469347 ATTTTACAAGTAATTCAAAGAGG + Exonic
1083361970 11:62115396-62115418 AATTTGCATATAAACAAAAGTGG + Intergenic
1083543488 11:63531439-63531461 AATTAGCATATAATTAAAAGTGG - Intergenic
1083700338 11:64473251-64473273 AATTTGCATGCAATTGAAATTGG + Intergenic
1083817806 11:65146802-65146824 AATTTGCATATAATTAAAAGTGG - Intergenic
1083908222 11:65688138-65688160 AATTTGCATATAATTAAAAGTGG + Intergenic
1083982421 11:66183805-66183827 AATTTGCATGTAATTAAGAGTGG - Intronic
1084186154 11:67472955-67472977 AATTTGCATGTAATTAAAAGTGG - Intergenic
1084240796 11:67818350-67818372 AATCTGCATGCAATTAAAAGTGG - Intergenic
1084406229 11:68975232-68975254 AACTTGCATATAATTGAAAGTGG + Intergenic
1084697767 11:70766103-70766125 AATGTGCATGTCCTTAAAAGAGG + Intronic
1084731831 11:71078790-71078812 AATTTGCATGTAATTAAAAGTGG + Intronic
1084831643 11:71774362-71774384 AATCTGCATGTAATTAAAAGTGG + Intergenic
1085357382 11:75850950-75850972 ACTGTGCCTGTAATTGAAAGTGG + Intronic
1086018574 11:82197527-82197549 AATTTGGAGGTAAGTGTAAGGGG - Intergenic
1086069799 11:82788061-82788083 AATTTGCATGAAAATAGAAGCGG - Intergenic
1086427631 11:86702440-86702462 AATTTGCATGTAGTTAAAAGTGG - Intergenic
1086553955 11:88087628-88087650 AATGTGCATGCAATTTAAATTGG - Intergenic
1086554421 11:88091900-88091922 CATTTGCATGTAATTGAAAGTGG - Intergenic
1086684267 11:89712932-89712954 AATTTGCACGTATTTAAAGGTGG + Intronic
1087444639 11:98234771-98234793 AATCTGCATGCAATTAAAAGTGG - Intergenic
1087464075 11:98483340-98483362 CATTTGCATTTACTTGTAAGTGG + Intergenic
1088181469 11:107117430-107117452 AATTTGCATGTAATTAAAAGTGG - Intergenic
1088380190 11:109184342-109184364 AATTTACATGTAATTGAAAGTGG - Intergenic
1090034837 11:123239904-123239926 AATTTGCAGGATATTAAAAGCGG - Intergenic
1090458883 11:126872320-126872342 AATTTGCATGTAAATAAAGGGGG + Intronic
1090712426 11:129399723-129399745 AATTTACATATAATTAAAAGGGG - Intronic
1090713838 11:129412574-129412596 AATTTGCATATAATTAAAAGTGG - Intronic
1091467093 12:694249-694271 AATTTGCATATAATTAAAAGTGG + Intergenic
1092135122 12:6141984-6142006 AACTTGCAAGTAATTGAAAGTGG - Intergenic
1092310238 12:7344308-7344330 AGATTGCATGTAGTTGAGAGAGG - Intergenic
1092520672 12:9269511-9269533 AATTTCCATGTAACTAAAATGGG + Intergenic
1092574507 12:9765137-9765159 AATTTGCATTAATTTGAGAGAGG - Intergenic
1092801831 12:12176116-12176138 AATTTTCATGTTTTTGATAGAGG - Intronic
1093227545 12:16503826-16503848 AATTTGCATTTAATTAAAAGTGG + Intronic
1093230072 12:16533170-16533192 AATTGGCATGTAAAAGACAGAGG + Intronic
1093380026 12:18480743-18480765 AATTTGCGTATAATTAAAGGTGG + Intronic
1093390251 12:18610074-18610096 AAGTGGCATGTAATAGAGAGTGG - Intronic
1093627822 12:21371078-21371100 AATCTGCATGTAGTTAAAAGTGG - Intronic
1093837049 12:23845202-23845224 AATTTCCATCTGATTGAAACAGG + Intronic
1094475955 12:30840718-30840740 AACTTGCATATTATTAAAAGTGG - Intergenic
1094581441 12:31737422-31737444 GATTTGCATGTAATTAGAAGTGG - Intergenic
1094709794 12:32950096-32950118 AATCTGCATACAATTAAAAGTGG + Intergenic
1095467271 12:42500458-42500480 AATCTGCATTTAAGTGGAAGAGG - Intronic
1097560684 12:61202204-61202226 AATTTGCATGCACTTTAAATAGG + Intergenic
1097878470 12:64665689-64665711 AATTTGCATGTAATTAAAAATGG + Intronic
1098335871 12:69403875-69403897 AATTTTCAAGTAAAAGAAAGTGG - Intergenic
1098505326 12:71242788-71242810 AATCTGGATTTTATTGAAAGGGG + Intronic
1098898909 12:76092649-76092671 AATTTACATATAATTAAAAGTGG + Intergenic
1098927321 12:76364850-76364872 AATTCACATGGAATTGCAAGGGG - Intronic
1099529689 12:83762737-83762759 AATCTGCATGCAATTAAAAGTGG + Intergenic
1099560793 12:84172283-84172305 AATTTGCATCTATTTGGAACTGG + Intergenic
1099562491 12:84195392-84195414 TATTTGCATGTAACTGAAAGTGG + Intergenic
1099638310 12:85246905-85246927 AATTTGCCTGGATTTGAATGAGG + Intronic
1099649412 12:85405394-85405416 AGTTTGCATGTAAATGTAAAGGG + Intergenic
1099869758 12:88332080-88332102 AGTTTGCATATAATTAAAAGTGG - Intergenic
1099920911 12:88956208-88956230 AATTTGATTGTAATTGACTGAGG + Intergenic
1100010132 12:89942934-89942956 AATTTGCATAGAATTAAAAGTGG - Intergenic
1100548959 12:95628792-95628814 AATTTGCATATAATTAAAAGTGG + Intergenic
1100793342 12:98154177-98154199 AAGTTGCATCTAACTGAAATGGG - Intergenic
1101147077 12:101851300-101851322 AATTTGCAAGTAATTAAAGGTGG - Intergenic
1101354299 12:103962699-103962721 GATTTGCATATAATTAGAAGTGG + Intronic
1101397537 12:104361665-104361687 AATTTGCATGTAATAAAAAGTGG + Intergenic
1101530464 12:105568773-105568795 AACTTGCATATAATTAAAAGTGG - Intergenic
1101796054 12:107975327-107975349 AATTTGCATATAATTAAAATGGG - Intergenic
1102433962 12:112905785-112905807 AATTTGCACGTATTTAAAAGTGG - Intergenic
1102448993 12:113026528-113026550 AATTTGCATATAATTAAAAATGG - Intergenic
1102449748 12:113032531-113032553 AATTTTCATATAATTAGAAGTGG + Intergenic
1103233901 12:119355753-119355775 AATTTGCATATAATTAAAAATGG - Intronic
1103247091 12:119467052-119467074 ATTCTACATGTAATTAAAAGTGG + Intronic
1103879001 12:124151667-124151689 AATTTGCATGTTATTGAAAGTGG - Intronic
1104232737 12:126900842-126900864 AATTTGAACTCAATTGAAAGTGG - Intergenic
1104249634 12:127079484-127079506 AATTTGCATTTAATTAAAATGGG - Intergenic
1104345384 12:127991821-127991843 AATTTGCATATAATTAAAAGTGG + Intergenic
1104552149 12:129766959-129766981 AACTAGCATATCATTGAAAGTGG + Intronic
1104561145 12:129845909-129845931 AATTTGCATGTAATTAAAAGTGG - Intronic
1104621123 12:130313558-130313580 TATTTTCATGTAATTAAAAGTGG + Intergenic
1104756044 12:131269865-131269887 AATTTGCATGTAATTAAGAGGGG - Intergenic
1105236473 13:18559804-18559826 ATTTTTCATGGAATTGAAACAGG + Intergenic
1105672025 13:22629686-22629708 AATTAACATATAATTAAAAGTGG + Intergenic
1105796254 13:23856483-23856505 AATTTGCATTTAAATAACAGTGG - Intronic
1107099093 13:36569325-36569347 AATTTGCATAGATTTGAAAGGGG + Intergenic
1107165368 13:37277035-37277057 AATTTGCCTTTATTTGGAAGTGG + Intergenic
1108048455 13:46405749-46405771 AATTTGCATATAATTGAAAGTGG + Intronic
1108096954 13:46912506-46912528 AATCTGCATGTAATTAGAAATGG - Intergenic
1108377719 13:49828861-49828883 AATTTGCATATACTTAAAAGTGG + Intergenic
1108773912 13:53739909-53739931 AATCTGCATGAAATTAAAAGTGG + Intergenic
1108862993 13:54885018-54885040 AATTTGCATGTAATTGAAAGTGG + Intergenic
1109379127 13:61535468-61535490 AATTAGCACATAATTAAAAGTGG + Intergenic
1109419013 13:62085420-62085442 AATCTGCATGTTATTAAAAGTGG + Intergenic
1109469119 13:62781013-62781035 ATTTTTCATTTAATTGAGAGAGG + Intergenic
1109505241 13:63292155-63292177 CATTTACATGTATTTCAAAGAGG + Intergenic
1110004313 13:70247378-70247400 AATTTGCTTATGAATGAAAGGGG - Intergenic
1110282320 13:73709188-73709210 TATTTGTAGGTATTTGAAAGAGG - Intronic
1110381993 13:74863173-74863195 AATTTGGATATAACTAAAAGGGG + Intergenic
1110998400 13:82143113-82143135 CATTTGAATGAAATTAAAAGAGG + Intergenic
1111225331 13:85263785-85263807 AATTTGCATGAAATTAAAAATGG + Intergenic
1111430719 13:88145634-88145656 AATCTGCATGTAATTAAAAGTGG + Intergenic
1111663837 13:91243207-91243229 AATTTGCATGCAATTGGAAGTGG - Intergenic
1111733710 13:92110209-92110231 TATTTGCATGTATTTGGAGGTGG - Intronic
1112022129 13:95380692-95380714 AATTTGCATATAGTCGAAAGTGG - Intergenic
1112139707 13:96625119-96625141 AATTCACACGTAATTAAAAGTGG - Intronic
1112276745 13:98028319-98028341 AATTGTCAGTTAATTGAAAGGGG - Intergenic
1112528510 13:100177365-100177387 AATTTGTCAGTAATTGAAAAAGG - Intronic
1112582481 13:100688409-100688431 AATTTGCATGTGCTTGAAAGTGG - Intergenic
1112583569 13:100697141-100697163 ACTTTGCATGTAATTGAAAGTGG - Intergenic
1112591104 13:100763650-100763672 AATTTGCACGTAATTATAAGTGG + Intergenic
1112751479 13:102588303-102588325 AATTTGCATGCAATTGTAAGTGG - Intergenic
1112966087 13:105196028-105196050 ATTTTGCAGGTAATTGAAGGAGG - Intergenic
1114865493 14:26589420-26589442 AATTTACTTGTAATTAAATGTGG + Intronic
1115002306 14:28438094-28438116 AATTTGCTTCTAATTAAAAGTGG - Intergenic
1116029706 14:39555985-39556007 AATTGGCAGGGAATTGAAAGAGG - Intergenic
1116145936 14:41069208-41069230 AATTTGCATGCAATTAAAAGGGG - Intergenic
1116220390 14:42077969-42077991 ATTTTGCAGGTAATTAAAAAAGG - Intergenic
1116239218 14:42320018-42320040 AATCTGTATATAATTGAAATGGG - Intergenic
1116287463 14:42990927-42990949 AATTTTCATGTAATTAAAAGTGG + Intergenic
1116535640 14:46025748-46025770 AAATTGTATGTAAATGCAAGTGG + Intergenic
1116558058 14:46338198-46338220 AATTTGCATGTAATTCAAGTGGG + Intergenic
1117128380 14:52657182-52657204 AATTTGCATATAATAAAAAGTGG + Intronic
1117273119 14:54165433-54165455 AATTTCCATATAAATGAAACTGG + Intergenic
1117880643 14:60310095-60310117 AATTTGCATATAATTAAAAGTGG - Intergenic
1118630510 14:67698228-67698250 AATTTGCATATAATTTCAGGTGG + Intergenic
1119032700 14:71204977-71204999 AATTTGCATATTATTAAAAGTGG - Intergenic
1119381245 14:74230175-74230197 AATTTGCATGCAATTTAAAGTGG - Intergenic
1120036728 14:79706352-79706374 TATTTGCATATATTTGAAAGTGG - Intronic
1120060363 14:79975585-79975607 AATTTGCATATAATTAAAAGTGG - Intergenic
1120106559 14:80502026-80502048 AATTTGCATATAATTAAAAGTGG + Intronic
1120327442 14:83049253-83049275 AATTTGCATGTAAATAAAAGTGG + Intergenic
1120328532 14:83058093-83058115 AATTTAGATGTAATTGCAAGTGG + Intergenic
1120813737 14:88831329-88831351 AATTTGCATGTAATTGAAAGTGG + Intronic
1121513990 14:94536818-94536840 AATTTGCGTGTAATTGAAGTTGG - Intergenic
1121896851 14:97656880-97656902 AATTTGCATTTAAATGGAAATGG - Intergenic
1122002698 14:98674844-98674866 AATTTGCATATAACTAAAAGTGG - Intergenic
1122850744 14:104528919-104528941 AATCTGCATGCAATTAAAAGTGG + Intronic
1122962346 14:105100988-105101010 AATTTGCATGTAATTAAAAGTGG + Intergenic
1123829615 15:24121058-24121080 AATTTACATGTAATTGAAAGTGG - Intergenic
1123835200 15:24182951-24182973 AATTTGCATATAATTAAAAGTGG - Intergenic
1123849957 15:24344307-24344329 AATTTGCATGTAATTAAAAGTGG - Intergenic
1123854896 15:24398862-24398884 AATTTGTGTATAATTAAAAGTGG - Intergenic
1123859612 15:24450722-24450744 AATTTACATGTAATTGAAAGTGG - Intergenic
1123870927 15:24571846-24571868 AATTTGCATATAATTAAAAGTGG - Intergenic
1124016706 15:25883093-25883115 GATTTGCCTGTGATTAAAAGTGG + Intergenic
1124435712 15:29647480-29647502 CATTTGCCTGTAAGTGAAACTGG - Intergenic
1124969359 15:34470135-34470157 AAATTGCATATAATCAAAAGGGG + Intergenic
1125357237 15:38829179-38829201 AATTTTCAAGGAATGGAAAGTGG + Intergenic
1125558205 15:40603837-40603859 AATTTGCATATAATTAAAAATGG - Intronic
1125757984 15:42078048-42078070 AATTTGCATGTAATTAAAAATGG + Intronic
1126082174 15:44974435-44974457 ACTTTGCATATAATTGTAAAAGG + Intronic
1127743426 15:61937930-61937952 AATTTGTAAGTACTTGAAACAGG - Intronic
1127758545 15:62115940-62115962 AAATTGCATGTAAATGAGATTGG - Intergenic
1128652065 15:69424144-69424166 ATTCTTCATGTAATTAAAAGTGG - Intronic
1129147968 15:73666460-73666482 AATTTGCATGTAATTAAAAGTGG - Intergenic
1129950498 15:79584904-79584926 TGTTAGCATGTAATTCAAAGAGG + Intergenic
1130361711 15:83193775-83193797 AATTTCCATGTAATTAAAAGTGG + Intronic
1130658765 15:85813305-85813327 ATTTTCCATGTTATTTAAAGTGG + Intergenic
1130943184 15:88528869-88528891 AATTTGGCTGTAAATTAAAGAGG + Intronic
1131192016 15:90324481-90324503 AATTTGCATGTAATTAAAAGTGG - Intergenic
1132097609 15:98999524-98999546 AATTTTTTTTTAATTGAAAGTGG + Intronic
1132479009 16:156846-156868 AATTTGCATATAATGAAAAGTGG - Intronic
1133122248 16:3616651-3616673 AATTCATATGTAATTGCAAGGGG + Intronic
1133165436 16:3943689-3943711 AATTTGCATGTAATTAAAAGTGG - Intergenic
1133352263 16:5109244-5109266 AATCTGCATGCAGTTAAAAGTGG - Intergenic
1133447875 16:5877738-5877760 AATTTGCATGTAATTAAAAGTGG - Intergenic
1133475232 16:6114942-6114964 AATTTGCATGTAACTGAAAATGG - Intronic
1133498757 16:6345355-6345377 AATTTCCATGTAATTAAAAGTGG - Intronic
1133549305 16:6838487-6838509 AATTTGCATGCAATTAAAAGTGG + Intronic
1133724366 16:8523629-8523651 CATTTGCATGTAATTAAAATTGG - Intergenic
1133970452 16:10564079-10564101 AATTTGCATATACTTAAAAGTGG - Intronic
1134401450 16:13913980-13914002 AATTTTCATATAATGAAAAGTGG - Intergenic
1134505002 16:14797971-14797993 CATATGCAACTAATTGAAAGCGG + Intronic
1134575572 16:15330938-15330960 CATATGCAACTAATTGAAAGCGG - Intergenic
1134726873 16:16425562-16425584 CATATGCAACTAATTGAAAGCGG + Intergenic
1134749971 16:16618166-16618188 AATTTGCATATCATTAAAAGTGG - Intergenic
1134940561 16:18286301-18286323 CATATGCAACTAATTGAAAGCGG - Intergenic
1134995505 16:18735449-18735471 AATTTGCATATCATTAAAAGTGG + Intergenic
1135491378 16:22912692-22912714 AATTTGCATGTAATTAGAAGTGG - Intronic
1135536489 16:23298426-23298448 AATTAGCATGTCATTAAAAGTGG - Intronic
1135596031 16:23744050-23744072 AATTTGAACTCAATTGAAAGTGG - Intergenic
1135783433 16:25326501-25326523 GATTTGCATGTAATTAAAAGTGG - Intergenic
1135793373 16:25419212-25419234 AATCTTCATGCAATTAAAAGTGG - Intergenic
1135794216 16:25425903-25425925 AATTTGCATGTAATTAAAAATGG + Intergenic
1135904583 16:26499474-26499496 AATTTGCATGTAATTAAAAGTGG + Intergenic
1135949309 16:26898385-26898407 AATTTGCATGTAATTAAAAATGG + Intergenic
1135980607 16:27143978-27144000 AATTTGCATTTAATTAAAAGTGG - Intergenic
1136358475 16:29762104-29762126 AATTTGCATGTGATTGAGAGTGG + Intergenic
1136646920 16:31628772-31628794 AGTTTGCATGTAATGAAAAGTGG + Intergenic
1136658262 16:31727502-31727524 AGTTTGCATGTAATGAAAAGTGG - Intronic
1136689377 16:32017939-32017961 AATTTGCATACAATTAAAAGTGG + Intergenic
1136789969 16:32961481-32961503 AATTTGCATACAATTAAAAGTGG + Intergenic
1136879843 16:33892455-33892477 AATTTGCATACAATTAAAAGTGG - Intergenic
1137357237 16:47778485-47778507 AATTTGCATATAATTAAAAGTGG - Intergenic
1137772801 16:51030584-51030606 ATTTTGCATATAATTAAAATTGG - Intergenic
1137834011 16:51573136-51573158 AATTTGCAAGGAATTGAAGAGGG + Intergenic
1138777430 16:59740888-59740910 AATTTGCATAAAATTGAAAGTGG - Intronic
1138800967 16:60029195-60029217 TATTTGCATGTTATAGAAACAGG + Intergenic
1138850813 16:60627442-60627464 AATTTGCGTACAATTAAAAGCGG - Intergenic
1138859291 16:60735934-60735956 AATTTGCATGCAATTAAAAGTGG + Intergenic
1138977536 16:62226035-62226057 AATTTGCATGTAATTAAAAGTGG + Intergenic
1139037545 16:62965898-62965920 ACTTAGCATATAATTAAAAGTGG - Intergenic
1139102462 16:63785247-63785269 AATTTGCATGTCATTTAAGCTGG - Intergenic
1139102897 16:63789586-63789608 AGTTTACATGTACTTGAAAGTGG - Intergenic
1139120193 16:64007118-64007140 AATTTGAATATATTTGAAGGTGG + Intergenic
1139509993 16:67422105-67422127 AATTTGCTTGTATTTGAAATGGG + Intergenic
1139681754 16:68570455-68570477 GATTTGCATGTAATTAAAAATGG - Intronic
1139827979 16:69772605-69772627 AACTTGCATATAATTAAAACTGG - Intronic
1139947159 16:70649295-70649317 AATCTGCATGCAATTAAAGGTGG - Intronic
1140020852 16:71237330-71237352 AATTTGCATATAATTTACAGTGG - Intergenic
1140300589 16:73753502-73753524 AATTTTCATGTAATTAAAAGTGG + Intergenic
1140339807 16:74146500-74146522 AATTTGCATGTAATTAAAAGTGG + Intergenic
1140348667 16:74240487-74240509 AATTTGTTTATAATTAAAAGTGG - Intergenic
1140543279 16:75780116-75780138 AATCTGCATGCAATTAAAAATGG + Intergenic
1140709089 16:77659680-77659702 AATTAGCAAGTACTAGAAAGAGG - Intergenic
1140838752 16:78819504-78819526 AATTTGCATATAATTAAAAATGG + Intronic
1141410947 16:83832741-83832763 AATTTGCATGTAATTAAAAGTGG + Intergenic
1142158011 16:88541529-88541551 AATTTGCATGTAATTGAAGAGGG - Intergenic
1142162615 16:88566455-88566477 AATCTGCATGTAATTAAAAGTGG + Intergenic
1142294299 16:89210327-89210349 AATTTGCATATAATTAAAAGTGG + Intergenic
1203092172 16_KI270728v1_random:1222944-1222966 AATTTGCATACAATTAAAAGTGG + Intergenic
1143368607 17:6424381-6424403 AATCTACATGTAATTAAAAGTGG + Exonic
1143437822 17:6942271-6942293 AATTTGCATATAATTAGAAGTGG + Intronic
1143441572 17:6978652-6978674 AATTAGCATGTCACTAAAAGTGG + Intronic
1143895767 17:10135137-10135159 AATCTACATGTAATTAAAAGAGG - Intronic
1144035733 17:11363870-11363892 AATTTGCATGTAATTAAAAGTGG + Intronic
1144281094 17:13727261-13727283 CATTTGCATGTAAATGAAAGTGG - Intergenic
1144413564 17:15024160-15024182 GATGTACATGTAATTAAAAGTGG - Intergenic
1144420310 17:15091790-15091812 ATTTTCCAAGTAATTGATAGAGG + Intergenic
1144424862 17:15132311-15132333 AATTTGCATGTAATTGAAAGTGG + Intergenic
1146087978 17:29847902-29847924 AATTTACATGTAATTGAAAGTGG + Intronic
1146658312 17:34648347-34648369 AATTTGCATATAATTAATAGTGG - Intergenic
1147152223 17:38524084-38524106 AATTTGCATACAATTAAAAGTGG + Intergenic
1147173653 17:38637092-38637114 TATTTACATGAAATTTAAAGGGG + Intergenic
1147431636 17:40375019-40375041 AATTTGCATATAACTAAAAGTGG - Intergenic
1147445464 17:40472606-40472628 AATTTGCATGTGTTTAAAAGTGG - Intergenic
1148668667 17:49393767-49393789 ATTTTGCATATAATTAAGAGTGG + Intronic
1148931116 17:51128153-51128175 ATTTTGCATGTGATTATAAGTGG - Intergenic
1148968382 17:51457232-51457254 TATTTGCATGAAGTTCAAAGGGG + Intergenic
1149270742 17:54974857-54974879 AATTTGCATATAATTAAAAGCGG - Intronic
1149895780 17:60427234-60427256 AATTTGCAAGTAATTAAAAGCGG - Intronic
1150062212 17:62078145-62078167 AATTTGCATGTAATTAAAAGTGG + Intergenic
1151077711 17:71293348-71293370 AATTTGCACATAATTAAAAGTGG + Intergenic
1151463728 17:74271352-74271374 AATTTGCATGTAATTAAAAATGG - Intergenic
1151775145 17:76196019-76196041 AATTTGCACATAATTAAAAGTGG + Intronic
1151905470 17:77045637-77045659 AACTGACATGTGATTGAAAGTGG + Intergenic
1152009606 17:77703894-77703916 AATTTGCATGTAATTGAAAGTGG - Intergenic
1152044485 17:77927039-77927061 AATCTGCATGCAATTAAAAGTGG - Intergenic
1152292263 17:79446680-79446702 AATTTGCATGCAATTAAAAGTGG + Intronic
1152803578 17:82343783-82343805 AATTTGCATGTAGTTAAAAGTGG + Intergenic
1152930385 17:83106345-83106367 AATTAGCATGTCATTAAAAGTGG - Intergenic
1153005033 18:490382-490404 CATTAGCAGGTAACTGAAAGAGG + Intronic
1153129734 18:1841192-1841214 AATTTGCATATAATTAAAAGTGG + Intergenic
1155523934 18:26697535-26697557 AATTTGCATGTAATTGAAAGTGG - Intergenic
1155679942 18:28476219-28476241 AATTTGCATATAATTAAAAATGG + Intergenic
1155680885 18:28483964-28483986 AATTTGTATACAATTAAAAGTGG + Intergenic
1156222780 18:35070433-35070455 TATTGGCATGTAATTAAAGGGGG + Intronic
1156558445 18:38093689-38093711 AATTTGTTCATAATTGAAAGGGG - Intergenic
1156590506 18:38482692-38482714 AATTTGCAGGGAAGTAAAAGGGG + Intergenic
1156644773 18:39147847-39147869 AATTTCCATATAGTTAAAAGTGG - Intergenic
1156645133 18:39151915-39151937 AATTTGTGTATAATTAAAAGTGG - Intergenic
1156802332 18:41131411-41131433 CATTTGCATGGATTTGGAAGAGG + Intergenic
1156835825 18:41553421-41553443 ACTTAGCAACTAATTGAAAGAGG - Intergenic
1156841039 18:41609619-41609641 AATTTGCATTTGATTCAAAGTGG - Intergenic
1157076305 18:44471411-44471433 AATTTGCATGTAATTGAAAGTGG + Intergenic
1157540530 18:48500683-48500705 AATTAACATGTAAGTCAAAGAGG + Intergenic
1159108470 18:64029286-64029308 AATTTGCATGTAATTATAAGAGG - Intergenic
1159156825 18:64594290-64594312 AATTTCCATGTATTTCAAAATGG - Intergenic
1159183556 18:64942517-64942539 AATTTGCATGTAAATAACAGTGG - Intergenic
1159184447 18:64950420-64950442 AATTTGCATGTAAGTAATAGCGG - Intergenic
1159185970 18:64974711-64974733 AATTTGCATGTAATTAAAAGTGG + Intergenic
1159213164 18:65356297-65356319 AATTTTCATGTAATTTTGAGAGG + Intergenic
1159246996 18:65819258-65819280 GATTTGCATGTAATTGAAATTGG + Intronic
1159262936 18:66039367-66039389 AATTTGCATATAATTAAAAGTGG + Intergenic
1159337076 18:67082055-67082077 AATTTGCATGCAATTGAATGTGG + Intergenic
1159503111 18:69298968-69298990 AATTTGCATGTAATTAAAAGCGG + Intergenic
1159616527 18:70586459-70586481 GTTTTGTATGTAATTGAAATTGG + Intergenic
1159653340 18:71003335-71003357 AACCTGCATGCAATTAAAAGTGG + Intergenic
1159902505 18:74060763-74060785 AGTTTGCATGTAATTTAAAGTGG + Intergenic
1160045189 18:75379882-75379904 CATTTTCTAGTAATTGAAAGAGG - Intergenic
1160062870 18:75548672-75548694 AATTTGCATGTAATTGAAAGTGG + Intergenic
1160481372 18:79243308-79243330 AATATGCATTTAATTGCAAGGGG + Intronic
1161248116 19:3266109-3266131 AATTTAAATGTAATTAAAAGTGG - Intronic
1161525791 19:4754249-4754271 AATTTGCATATAATTAAAAGTGG - Intergenic
1161859982 19:6790760-6790782 GATTTGCATATAATTAAAACGGG - Intronic
1161861774 19:6803266-6803288 AATTTGCATATAATTAAAGTGGG - Intronic
1162089565 19:8270136-8270158 AATCTGCATGCGATTAAAAGTGG + Intronic
1162219525 19:9164319-9164341 AATTTGCATGTAATTAAAACTGG - Intergenic
1162663019 19:12185120-12185142 AATTTGCATATAATTGAAAGTGG - Intronic
1162880433 19:13654812-13654834 AATTTACACATAATTAAAAGTGG - Intergenic
1162990762 19:14300615-14300637 AATTTGCATATAATTAAAAATGG + Intergenic
1163512444 19:17743598-17743620 CATTTGCATATAATTAAAAGTGG - Intergenic
1163568317 19:18065034-18065056 CATTTGCATATAATTAAAAGCGG + Intronic
1163615600 19:18326080-18326102 AATGTGACTGTAATTGAAATAGG - Intergenic
1163897609 19:20073361-20073383 AATTTGAATTGAATTGAATGTGG - Intergenic
1163906540 19:20153526-20153548 AATTTGAACTTAATTGAACGTGG + Intergenic
1163922505 19:20305059-20305081 GATTTGCATGTAACTGTAAAAGG + Intergenic
1164412125 19:28014780-28014802 AATCTACATGTGATTAAAAGTGG + Intergenic
1164454574 19:28396598-28396620 AATTTGCATATAATTACAGGTGG + Intergenic
1164561005 19:29292255-29292277 AATTTGCATGTCATTAAAAGTGG - Intergenic
1164572507 19:29384735-29384757 AATCTGCATGTAATTAAAAGTGG - Intergenic
1164675790 19:30100348-30100370 AATTTGCACGTGATTGAAAGTGG + Intergenic
1164855826 19:31519966-31519988 AATTTGCATGTAATTAAAAGTGG - Intergenic
1164897515 19:31890212-31890234 ACTCTGCATGTAATTAAAAGTGG - Intergenic
1165103146 19:33451013-33451035 ACTCTGCATGTAATTAAAAGTGG + Intronic
1165134742 19:33660738-33660760 AGTTTGCATGCAATTGAAAGTGG + Intronic
1165278612 19:34776843-34776865 AATCTGCATGTAATTAAAAGTGG - Intergenic
1165876455 19:39011070-39011092 AATTCACATGGAATTGCAAGAGG - Intronic
1165881373 19:39046358-39046380 AATTTGCATGTAACTGAAAGTGG + Intergenic
1166955281 19:46460122-46460144 AATTTGCATATAATTAAAAGTGG - Intergenic
1166957247 19:46472734-46472756 AATTAGCACGTCATTAAAAGTGG - Intergenic
1167082934 19:47289712-47289734 GATTTGCATATAATTAAAAGTGG - Intergenic
1167652488 19:50740371-50740393 AATTTGCATATAATTAAAAGTGG + Intergenic
1167677892 19:50899687-50899709 AATTTGCATGTAATTGAAAGTGG - Intergenic
1167692426 19:50994649-50994671 AATTTGCATGTAATTGAAAATGG + Intergenic
1167819172 19:51910345-51910367 ACTTTGCATATAATTAAAAGTGG + Intronic
1167975914 19:53225863-53225885 AGTTTGCATGTAATTAAAAGTGG + Intergenic
1168582789 19:57569372-57569394 CCTTTGCATGTAGTTAAAAGCGG + Intergenic
924980245 2:212999-213021 AATTTCCATGTAGATGAAACAGG - Intergenic
925027111 2:618750-618772 AATCTGCATGCAATTAAAAGTGG + Intergenic
925475261 2:4206263-4206285 TATTTGCATATAATTAAAAATGG - Intergenic
926115746 2:10212155-10212177 AATTTGCATGTAATTAAAAGTGG + Intergenic
926144636 2:10389239-10389261 AATTTGCATGTAATTAAAAGTGG + Intronic
926340882 2:11903376-11903398 AATCTGCATGCAATTAAAAGTGG + Intergenic
926438339 2:12860482-12860504 AATTTGCATATACTTAAAAGTGG - Intergenic
926564453 2:14454412-14454434 AATTTGCATGTAATTAAAAATGG + Intergenic
927033506 2:19147774-19147796 AATTTGCTAATAATTGACAGTGG - Intergenic
927346034 2:22042154-22042176 AATGTATATGTAATTGAAAGGGG + Intergenic
927382359 2:22493459-22493481 AATCTGCATGTTATTAAAAGTGG + Intergenic
927496852 2:23556895-23556917 CATGTGCATGTAATTTAAACAGG + Intronic
927536969 2:23870591-23870613 AATTTGGATGTAATTTAAATTGG - Intronic
927671103 2:25069638-25069660 AATCTGCATATAATTAAAAGTGG - Intronic
927728017 2:25443238-25443260 TATTTGCATGTAATAGTAAATGG - Intronic
927767464 2:25825274-25825296 ATTTTGCATTTATTTGAATGGGG - Intronic
928734293 2:34268020-34268042 AATTTCCATGTAATTGGGTGTGG + Intergenic
928973813 2:37062459-37062481 TATTAGCATGTTTTTGAAAGAGG + Intronic
929093816 2:38245318-38245340 AAGTAGCATGTCATTAAAAGTGG + Intergenic
929324709 2:40595257-40595279 AATTTTAATTTATTTGAAAGTGG + Intronic
929871972 2:45766706-45766728 AATTTGAATGTGAGTGGAAGAGG - Intronic
930072580 2:47379693-47379715 AATTTGTATGTAATTATATGTGG + Intronic
930261581 2:49153218-49153240 GATTTGCATTTAATTGAAGAAGG - Intronic
930529874 2:52575505-52575527 AATTTACATGGAAATGAAAAAGG - Intergenic
930822183 2:55657733-55657755 AATTTGCAGGAAATAGAGAGGGG + Intronic
930863715 2:56102523-56102545 AATTTGCTTGTAATTGAAAGTGG + Intergenic
930891180 2:56389705-56389727 AATCTGCATGCAATTAAAAGTGG - Intergenic
930903087 2:56532012-56532034 AATTTGCATGTAATTGGAAGTGG - Intergenic
931072623 2:58670065-58670087 AATTTGCATGTAATTAAAAGTGG - Intergenic
931093970 2:58919028-58919050 ACTTTGCATGTAAATGTAACAGG - Intergenic
931821230 2:65954431-65954453 ACTTTGCATGGAATAAAAAGTGG - Intergenic
931965437 2:67528697-67528719 AATTTGCATATAATTGGAAATGG + Intergenic
931972128 2:67600481-67600503 AATTTGTATGTAATTATAAGTGG - Intergenic
932789876 2:74645666-74645688 AATTTGCATGTAATTAAAACTGG + Intronic
933032838 2:77354026-77354048 AATTTGCATGTAATTAAAAGTGG - Intronic
933486893 2:82935471-82935493 AATTTACTTGCAATTGAAAGTGG + Intergenic
933618044 2:84504845-84504867 AATTCACATGGAATTGCAAGGGG - Intergenic
933670181 2:84999695-84999717 TATTTGCATATAAGAGAAAGGGG + Intronic
933941891 2:87251993-87252015 AACTTGCATGTAATTAAAAGTGG - Intergenic
934134480 2:88982534-88982556 TATTAGCATGTCATTAAAAGTGG - Intergenic
934235826 2:90231246-90231268 TATTAGCATGTCATTAAAAGTGG + Intergenic
934719932 2:96566824-96566846 AATTTGCATATAATTAAAAGTGG + Intergenic
934890435 2:98063624-98063646 AATTTGCATATAATTAAAAGTGG + Intergenic
935120322 2:100178421-100178443 AATTTGCATATAATTGAAAGTGG + Intergenic
935288433 2:101587850-101587872 AATTTGCACATAATTAAAAGTGG - Intergenic
935876614 2:107514629-107514651 AATTTTCATGTAATTAAAAGTGG + Intergenic
936338331 2:111609576-111609598 AACTTGCATGTAATTAAAAGTGG + Intergenic
936344939 2:111668278-111668300 AATTTGCATGTAATTAAAAGTGG + Intergenic
937502511 2:122495415-122495437 AATTTATATGGAATTGCAAGGGG - Intergenic
937502936 2:122502814-122502836 CATTGGCATGTAATCTAAAGTGG - Intergenic
937634176 2:124137342-124137364 TATTTGCATATAAATGAAAAAGG + Intronic
938255460 2:129856553-129856575 AATTTGCATGGAATTTTAAGAGG + Intergenic
938584394 2:132674967-132674989 AATTGGCATGGTGTTGAAAGGGG - Intronic
939539852 2:143480551-143480573 AATCTGGAAATAATTGAAAGAGG - Intronic
939810090 2:146821014-146821036 GCTTTGAATGTAATAGAAAGAGG + Intergenic
939913831 2:148015981-148016003 ACTTCTCATGTAATTGTAAGAGG - Intronic
940122870 2:150287114-150287136 AATTTGCATATAATTCAAAGTGG - Intergenic
940123849 2:150300063-150300085 AATATGCATATAATTAAAAGTGG + Intergenic
940243228 2:151586041-151586063 CATTTGGATGTAATTAAAAATGG + Intronic
940244184 2:151596594-151596616 CATTTGGATGTAATTAAAAATGG + Intronic
940489899 2:154345919-154345941 AATTTGGATGCAGTAGAAAGAGG - Intronic
941226906 2:162861729-162861751 AATGTGAATCTAAATGAAAGGGG + Intergenic
941465350 2:165819116-165819138 AAGTTGCATGTGTTTTAAAGGGG + Intergenic
941714555 2:168749941-168749963 AATGTGAATGTAATTAAAAGTGG - Intronic
942016767 2:171825538-171825560 AATGTGCATGCTATAGAAAGAGG - Intronic
942389053 2:175473008-175473030 AAGTTGAATGTGATTGAGAGTGG + Intergenic
943012500 2:182467309-182467331 ATTTTGCACCTAAATGAAAGGGG + Intronic
943043132 2:182826714-182826736 AATCTGCATGTAATACAAGGTGG - Intergenic
943226897 2:185188980-185189002 AAATTCCATATAATTGTAAGAGG - Intergenic
943261174 2:185665555-185665577 AATTTGCATATAATTAAAATTGG + Intergenic
943442909 2:187947977-187947999 AATCTGCATGCAATTAAAAGTGG + Intergenic
943469330 2:188274401-188274423 AGTCTGCATGTAATTAAAAGTGG + Intergenic
943849355 2:192697301-192697323 ATTTTGCATATAGTTGAAGGGGG - Intergenic
943883612 2:193181972-193181994 AATTTGCGTGTGATTAAAGGTGG + Intergenic
943883723 2:193183444-193183466 AATTAGCATATAATTAAGAGTGG - Intergenic
944088084 2:195872224-195872246 AATTTTCCTGTTATTGAAATGGG - Intronic
944173898 2:196808268-196808290 AATTTGCATATATTCAAAAGTGG - Intronic
944435240 2:199681764-199681786 AATTTGTATGTTATTTAAAGTGG - Intergenic
944572315 2:201056941-201056963 TATTGGCATGTAATAGGAAGAGG - Intronic
944649668 2:201816939-201816961 AATTTGCATATAACTAAAAGTGG + Intronic
945612976 2:212029135-212029157 AATCTGCATGTAATTAAAAGTGG + Intronic
946058848 2:216924322-216924344 AGTTTGCATATAATTAGAAGTGG + Intergenic
946521644 2:220471321-220471343 TATTTTCATATAATTGAAATGGG - Intergenic
946634777 2:221712610-221712632 AATTTGCATTTTATTCTAAGAGG - Intergenic
946662618 2:222017820-222017842 AATATGCCTGTAACAGAAAGAGG + Intergenic
946805879 2:223470997-223471019 AATTTGCATGTAATTAAAAGTGG - Intergenic
946806663 2:223477334-223477356 AATTTGCATGTAATTAAAAGTGG - Intergenic
946887853 2:224242120-224242142 AATTTGCATATAATTAAAAATGG + Intergenic
946928607 2:224650303-224650325 AATTTGCATATAATTAAAATTGG + Intergenic
947617180 2:231565704-231565726 AATTTGCATGTAATTAAAAGTGG - Intergenic
948107989 2:235430433-235430455 AATTTGCATGTAATTAAAAGTGG - Intergenic
948557530 2:238823833-238823855 AATTTGTATGTAATTAAAAGTGG + Intergenic
948675881 2:239596393-239596415 AATCTGCATGCAATTAAAAGTGG - Intergenic
948880527 2:240855056-240855078 CATTTGCATGTCACTAAAAGTGG - Intergenic
1168884739 20:1240816-1240838 AATCTGCATACAATTAAAAGTGG + Intronic
1168909422 20:1435253-1435275 AATTTGCATGTAATTAAAAATGG + Intergenic
1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG + Intergenic
1169501857 20:6168217-6168239 AATTTGCATATAATTAAAAGTGG - Intergenic
1169719035 20:8652169-8652191 AATTTGCCTGCAATTGACATTGG - Intronic
1170121722 20:12919492-12919514 AATTTGTATGTCATTAAAAGTGG + Intergenic
1170461569 20:16581638-16581660 AATTTGCATATAATTAAAAGTGG - Intergenic
1170753693 20:19176782-19176804 AATTTGCATGTAATTATGAGTGG + Intergenic
1171022188 20:21595831-21595853 AATTAGCATGTGATTCAAAGTGG - Intergenic
1171083966 20:22218776-22218798 AATTTGCAGGTAATTTCAATGGG + Intergenic
1171171009 20:23015399-23015421 AATTTACATGTAATTAAAACTGG - Intergenic
1171723208 20:28587326-28587348 AATTTAAATTTAAATGAAAGAGG - Intergenic
1171754840 20:29095781-29095803 AATTTAAATTTAAATGAAAGAGG + Intergenic
1171860136 20:30392630-30392652 AATTTAAATTTAAATGAAAGAGG + Intronic
1172199234 20:33113552-33113574 AACTAGCATGTAATTAAAAGTGG - Intergenic
1172246777 20:33450857-33450879 AATTTGTGTATAATTAAAAGTGG - Intergenic
1172319624 20:33986203-33986225 AATTTGCATGTAATTAAAAGTGG + Intergenic
1172514800 20:35525851-35525873 AATTTGCATGTAGTTAAAAGTGG - Intronic
1172570703 20:35968140-35968162 AATTTGCATGTGATTGAAAGTGG - Intronic
1172582895 20:36062610-36062632 AATTTGCATGTAAATAAAAGTGG + Intergenic
1172803847 20:37597428-37597450 AATTTGCGTATAATTAAAAATGG + Intergenic
1173486389 20:43444405-43444427 AATTTGCATGTAATTAAAAGTGG + Intergenic
1173887008 20:46468590-46468612 AATTTGCATATATTTAAAAGTGG - Intergenic
1173891981 20:46519808-46519830 AATTTACATGTAATTGAAAGTGG + Intergenic
1174140788 20:48412266-48412288 AATTAGCATATAATTAAAAGTGG + Intergenic
1174949317 20:55027367-55027389 AATTAGCATGTCAGTAAAAGTGG - Intergenic
1174950508 20:55036646-55036668 AGTTAGCATGTCATTAAAAGTGG - Intergenic
1175138120 20:56840184-56840206 AATTTGCATTTAATTAAAAGTGG - Intergenic
1175292718 20:57888690-57888712 CATTTGCATATAATTGGAGGTGG + Intergenic
1175509616 20:59515044-59515066 ACTTTGCATGTAATTAAAAGTGG - Intergenic
1175569393 20:60007527-60007549 AATTTGCATGTAATTGAAAGTGG - Intronic
1175675435 20:60942721-60942743 AATCTGCATGTTATTAAAAGTGG + Intergenic
1175709398 20:61206975-61206997 ACTTTGCATGTCATTTTAAGTGG - Intergenic
1176518024 21:7800887-7800909 AATTTGCATATAATTAAAAGTGG - Intergenic
1176780463 21:13188089-13188111 ATTTTTCATGGAATTGAAACAGG + Intergenic
1177355764 21:20004728-20004750 AATTTGCATGTAATTGAAGTGGG + Intergenic
1177368337 21:20168313-20168335 AATTTGCATATAATTTAAAGAGG + Intergenic
1177925400 21:27208205-27208227 AATGAGCATATAACTGAAAGAGG + Intergenic
1178042346 21:28653029-28653051 AATTTGCATGTAATTGAAAGTGG + Intergenic
1178240416 21:30893470-30893492 TATTTGCATGTAATTAAAAGTGG + Intergenic
1178339784 21:31776385-31776407 AATGTGCATGAAATAGTAAGAGG - Intergenic
1178652052 21:34430900-34430922 AATTTGCATATAATTAAAAGTGG - Intergenic
1178974640 21:37210328-37210350 AATTTACATATAATTAAAAGTGG - Intergenic
1179413546 21:41180109-41180131 CATTTGCATATAATTAAAAGTGG - Intronic
1179427361 21:41292321-41292343 AATTTGCATATAATTAAAAGTGG - Intergenic
1180296769 22:10945976-10945998 AATTTAAATTTAAATGAAAGAGG - Intergenic
1180411837 22:12619584-12619606 AATTTAAATTTAAATGAAAGAGG + Intergenic
1181447601 22:22990046-22990068 AATCTGCATGTTATTAAAAGTGG - Intergenic
1181753663 22:25007761-25007783 GACTTGCATGTAATTAAAAGTGG + Intronic
1181754917 22:25016994-25017016 AATTTGCATATAATTAAAAGTGG - Intronic
1181910015 22:26231191-26231213 AATTTGCATGTAATTAAAAGTGG - Intronic
1182029600 22:27147477-27147499 AATTTGCATATAATTAAAAGTGG + Intergenic
1182111092 22:27724273-27724295 AATTTGCATGTAATGAGAAGTGG - Intergenic
1182186275 22:28405859-28405881 CATTTGCATGTAATTAAAAGTGG + Intronic
1182192182 22:28473552-28473574 GATTTGCATATAATTAAAAGTGG + Intronic
1182743796 22:32589017-32589039 AATTTGCATGTAATTAAAATGGG + Intronic
1182971591 22:34584285-34584307 AATTTGCATATAATTAAAAGTGG - Intergenic
1183336456 22:37250210-37250232 AATTTGCATGTGACTAAAAGTGG + Intergenic
1183356009 22:37359928-37359950 AATTTGCATGTGATGAAAAGTGG - Intergenic
1183560077 22:38565492-38565514 AATTTGCACGTAATTAAAAGTGG + Intronic
1183566922 22:38622149-38622171 AATTTGCCTGTAATTAAAAGTGG + Intronic
1183609346 22:38887605-38887627 AATTTGCATGGAATCAAAAAAGG + Intergenic
1184434842 22:44464946-44464968 AATTTGCATGTAATTAAAAGTGG - Intergenic
1184612739 22:45615421-45615443 AATGTACATATAATTAAAAGTGG - Intergenic
1184632473 22:45793991-45794013 AATTCGCATATAGTTAAAAGTGG - Intronic
1184866912 22:47206474-47206496 AATTTACATGTAATTAAAAGTGG + Intergenic
1184964064 22:47954209-47954231 AATTTGCATATAATTAAAAGTGG - Intergenic
1185006971 22:48285011-48285033 ATTTTGCATATAACTAAAAGGGG + Intergenic
1185131895 22:49044021-49044043 AATTAGCATGTAGTTAAAAGTGG - Intergenic
1185242919 22:49756006-49756028 AATTTGCATGTAATTGAAAGTGG + Intergenic
1185300064 22:50074885-50074907 AATTAGCATATACTTAAAAGTGG + Intronic
949201370 3:1383792-1383814 AATTTGCATGTAATTAGAAGTGG - Intronic
949255097 3:2036379-2036401 AATTTGCATATAATTAAAAGTGG + Intergenic
949712281 3:6885330-6885352 AATTTGCATATAATTAAAAGTGG - Intronic
949737230 3:7187662-7187684 AATCTGCATGTAATTAAAAGTGG - Intronic
950191240 3:10977888-10977910 TATTTGCATGCATTTGGAAGAGG - Intergenic
950513977 3:13451956-13451978 AATTAGCATGTCTTTTAAAGTGG + Intergenic
950629742 3:14274566-14274588 AATTTGCATATAATCAAAAGTGG - Intergenic
950685060 3:14611051-14611073 AATTTGCATGTAATAAAAAGTGG - Intergenic
950779375 3:15378196-15378218 AATATACAAGTAATTGAAAGTGG - Intergenic
951734267 3:25847149-25847171 ATTTTGCATGTATATGAAAAAGG + Intergenic
952100310 3:30003666-30003688 AATCTGTATTTAAATGAAAGTGG + Intronic
952236212 3:31482649-31482671 AACTTGCATATGATTCAAAGGGG - Intergenic
952564455 3:34638201-34638223 AATTTGCATGTAGTTAAAAGTGG - Intergenic
952629570 3:35449545-35449567 AATTTACATGGAAATGAAAAGGG + Intergenic
953408189 3:42670676-42670698 AATTTGCATGTAAGTCAAAGTGG - Intergenic
954163084 3:48735569-48735591 AATCTGCATGCAATTAAAAGTGG - Intronic
954320070 3:49826447-49826469 AATTTATATGGAATTGCAAGAGG - Intergenic
954803501 3:53201365-53201387 AATTTGCATATAATTAAAAGTGG + Intergenic
955276752 3:57554387-57554409 AATTTTCATTTTCTTGAAAGGGG - Intergenic
956484907 3:69711746-69711768 AATTTGCATATAATTAAAAGTGG + Intergenic
956489983 3:69760512-69760534 GATTTGCATGTAATTCCAAGTGG - Intronic
956879005 3:73491417-73491439 AATTTGCATCTTCTTGAAATGGG - Intronic
956907724 3:73783953-73783975 AATCAGCAGGTAATTTAAAGAGG - Intergenic
957056263 3:75445147-75445169 AATCTGCATACAATTAAAAGTGG - Intergenic
957200595 3:77130128-77130150 ACTTTTCATGTAGTTGTAAGAGG + Intronic
957415352 3:79895164-79895186 CATTTGCATGTAATTAAAAGTGG + Intergenic
957821223 3:85376196-85376218 AACATGCATGTAATTTAGAGAGG - Intronic
958150256 3:89684130-89684152 AATTTGCATCTTACTGAAAGGGG + Intergenic
958571319 3:95885885-95885907 AAATTGCATGTTAATGTAAGGGG + Intergenic
958709666 3:97702164-97702186 AAAATCCATGTAAGTGAAAGGGG - Intronic
958835970 3:99145442-99145464 AATGTGAATGTATTTGAAGGAGG + Intergenic
959061905 3:101623733-101623755 AATTTCCATATAATTAAAAGTGG - Intergenic
959208535 3:103344842-103344864 AATTGTCATGGAATTGCAAGGGG + Intergenic
959266224 3:104142298-104142320 AATTTGCATTTGATTAAAAGGGG + Intergenic
959333041 3:105030602-105030624 AATTTGCATATAATTAAAAGTGG + Intergenic
959458330 3:106591765-106591787 AATTTGCATATAATTAAAAATGG + Intergenic
959770631 3:110090885-110090907 AATTTGCATGTAATGGTAAGTGG - Intergenic
959780541 3:110227627-110227649 AATTTGCATGTAATTAAAAGTGG + Intergenic
961298124 3:125903560-125903582 AATCTGCATGCAATTAAAAGTGG + Intergenic
961503572 3:127355281-127355303 AATTTGCATGTAATTAAAAGTGG - Intergenic
961527233 3:127512904-127512926 AATTTGCATGTAATTAAACATGG + Intergenic
961744941 3:129058686-129058708 AATTTGCATGTAATGAATAGTGG + Intergenic
962678473 3:137773923-137773945 CATTTGCGTGTCATTGAAAGAGG - Intergenic
962697396 3:137963620-137963642 AATTTGCATGAAATTAAAGGTGG - Intergenic
962906025 3:139803746-139803768 AATTTTAATTTATTTGAAAGTGG - Intergenic
963223295 3:142834287-142834309 AATGTGCATGGGATTGCAAGGGG - Intronic
964197297 3:154079518-154079540 AATTTGCACATAATTAAAAGTGG - Intergenic
964785430 3:160391034-160391056 AATTTGCATATAGCTAAAAGTGG + Intronic
964978092 3:162643819-162643841 AATTTTCATATAATTAAAATTGG - Intergenic
965043368 3:163541033-163541055 AATTTGCCTGTAACTGACTGAGG + Intergenic
965326322 3:167309098-167309120 AATTTGCATGTAATTAAAAGTGG + Intronic
965421328 3:168462852-168462874 GATTTGCATGAAATTTAAAAAGG - Intergenic
965581497 3:170272876-170272898 ATTTTACATGTAATTTTAAGAGG + Intronic
966072566 3:175896452-175896474 AATTTGCATATAATTTAAAGTGG + Intergenic
966414838 3:179677990-179678012 GAGTTGCATGAAATTTAAAGGGG - Intronic
966525081 3:180911894-180911916 AATTTGCATGCATTTAACAGAGG + Intronic
966642921 3:182210374-182210396 AATTAGAATGTAATTGTGAGGGG + Intergenic
967456420 3:189691509-189691531 TATTGGCATCTAATGGAAAGAGG - Intronic
967620498 3:191627942-191627964 AATTTGTATGTAATTAAAAGTGG + Intergenic
967843605 3:194027265-194027287 AATTTGCATATAGTTAAAGGTGG - Intergenic
968600118 4:1504709-1504731 AATTTGCATATCATTAAAAGTGG - Intergenic
969191522 4:5524919-5524941 AATTAGCATATAATTAAAAGTGG - Intronic
969218463 4:5742988-5743010 CATTTGCATGTAATTGAAAGTGG - Intronic
969356836 4:6632924-6632946 AATTTTCACATAATTAAAAGTGG - Intergenic
969359104 4:6650177-6650199 AATTTGCATGTAATTAAAAGTGG + Intergenic
969698915 4:8754974-8754996 AATTTGCATATAATTAAAGCTGG + Intergenic
969754927 4:9143206-9143228 AATCTGCATGCAATTAAAAGTGG + Intergenic
969814829 4:9679489-9679511 AATCTGCATGCAATTAAAAGTGG + Intergenic
970073210 4:12186838-12186860 AATTTGCATGCAATTAAAAGTGG - Intergenic
970232879 4:13928750-13928772 AATTTGAATGTAATCAAAAAAGG + Intergenic
970431238 4:15990843-15990865 AATTAGCATTCCATTGAAAGCGG + Intronic
970788750 4:19831616-19831638 CAGTTGAATGTAATTGAAAGAGG - Intergenic
971602858 4:28617888-28617910 AATTTGCATGTGATTTATAGAGG + Intergenic
972413017 4:38811618-38811640 AATCTGCATGCAATTAAAAGTGG + Intronic
972942317 4:44211762-44211784 AACTTACATATAATTAAAAGAGG + Intronic
973148514 4:46859839-46859861 AATTTGCATGTAATTAAAAGTGG + Intronic
973149335 4:46867548-46867570 AATTTGCGTGTAATTAATAGTGG + Intronic
973676929 4:53273542-53273564 AAATGGCATAAAATTGAAAGAGG + Intronic
973877725 4:55237479-55237501 AATCTGTCTATAATTGAAAGTGG + Intergenic
974100329 4:57409474-57409496 AGTTTGGATGTAAATGAATGGGG + Intergenic
974522290 4:62997715-62997737 AATTTGCCTATTGTTGAAAGTGG - Intergenic
975909947 4:79255853-79255875 AATCTGCATGCCATTAAAAGTGG - Intronic
975966310 4:79976561-79976583 AATTTTCATATAATTAAAAGTGG + Intronic
976915363 4:90367422-90367444 AATTTGTATGTAATTAGTAGTGG + Intronic
977147735 4:93466501-93466523 AATCTGCATGCAGTTAAAAGTGG - Intronic
977157072 4:93587892-93587914 ATTTTGCATATTATTAAAAGCGG + Intronic
977262282 4:94812328-94812350 TATTTGCCTGGAATGGAAAGGGG + Intronic
977825274 4:101523947-101523969 AATTTGTATGTGATTGAAAGTGG + Intronic
977889116 4:102287230-102287252 ATTTTGCATACAATTTAAAGGGG - Intronic
978076671 4:104539726-104539748 AATTTCCATGAAAATGAAATGGG - Intergenic
979340667 4:119519469-119519491 AATCTGCAGGGAATTAAAAGAGG - Intronic
979647892 4:123093304-123093326 AATTTGCATGTAAATGAAAGTGG - Intronic
979859951 4:125681516-125681538 CATTTGCATGTTGCTGAAAGGGG + Intergenic
979909893 4:126350344-126350366 AATTTTCATTAAATTTAAAGAGG - Intergenic
980029340 4:127808632-127808654 ATTTTGCATGTGAGTGAAATGGG - Intronic
980334919 4:131459820-131459842 AATTAGCATATACTTAAAAGAGG + Intergenic
980434762 4:132756446-132756468 AATTTGCATATAATTAAAAGTGG - Intergenic
980959127 4:139457218-139457240 TATGTGCAGGTAGTTGAAAGAGG + Intronic
981245218 4:142528458-142528480 AATTTGCAAGGAATAGAGAGTGG - Intronic
981290253 4:143066823-143066845 CATTTGCAGGTAATTGAAACTGG - Intergenic
981916525 4:150039902-150039924 AATTAGCATGTCATTAAAAGTGG - Intergenic
982371896 4:154642741-154642763 AATTTGCATGTAATTGACATTGG + Intronic
982378872 4:154726321-154726343 ACTTTGCATGTAATTGCTAGTGG - Intronic
983680804 4:170351532-170351554 AATCTGCATGCAATTAAGAGTGG - Intergenic
983782485 4:171687995-171688017 AATTTGCATGAAATTAAAAGTGG + Intergenic
984274817 4:177597095-177597117 AATTTGCATGTAGTTAAAAGTGG - Intergenic
984444766 4:179822812-179822834 AATTTGCACTTAATTCAAATAGG + Intergenic
984567936 4:181353544-181353566 CATATGCATGTAAAAGAAAGTGG + Intergenic
984762284 4:183373006-183373028 CATTTGCAAGTAGTTAAAAGGGG - Intergenic
985438303 4:189956459-189956481 AATTTAAATTTAAATGAAAGAGG + Intronic
985690902 5:1311728-1311750 AGTCTACATGTAATTAAAAGTGG - Intergenic
985700469 5:1368866-1368888 AAGTTGCACGTAATTGAAAGCGG + Intergenic
985968640 5:3357200-3357222 TATGTGCATCTTATTGAAAGGGG + Intergenic
986201805 5:5586031-5586053 AATTTGCAGGTAATTGAAAGTGG - Intergenic
986209501 5:5657371-5657393 AAATTGCATGTAGTTGAAAATGG + Intergenic
986829165 5:11557370-11557392 AACTTGCATGAACTTGAAAGGGG - Intronic
987163204 5:15166639-15166661 AGTTTGTATATAATTAAAAGTGG + Intergenic
987197729 5:15544050-15544072 AATTTGCATGTAATTAAAAGTGG + Intronic
987270236 5:16300455-16300477 AATTTGCATGTGAATGAAATGGG - Intergenic
987496939 5:18658245-18658267 AATCTGCATGCAATTAAAAGTGG - Intergenic
988225527 5:28407467-28407489 AATTTGCATATATTTGAAAGTGG - Intergenic
988444196 5:31266923-31266945 CATTTGAATTCAATTGAAAGTGG - Intronic
988936635 5:36090033-36090055 AATTTGCATGTAATTGAAAGTGG - Intergenic
989311322 5:40022095-40022117 AGTTTGCATGCAATTGAAAGTGG - Intergenic
989802319 5:45558484-45558506 ATTTTCAATGTAAATGAAAGAGG + Intronic
990542074 5:56783023-56783045 AATTTGAATGTCCTTGAAATAGG + Intergenic
990616006 5:57508970-57508992 AATTTGCATATAATTAAAAGTGG + Intergenic
990868365 5:60404353-60404375 AACCTGAATGTAATTGAAACTGG + Intronic
990939962 5:61192120-61192142 GATTGGCATGGAATTGAAATTGG - Intergenic
990994172 5:61714601-61714623 AGTTTGCAAGTAGTTGGAAGAGG - Intronic
991004360 5:61813143-61813165 AGTTGGCATGAAATTAAAAGTGG - Intergenic
991562744 5:67971738-67971760 AAGTTGCAAGTAACTGAAATAGG + Intergenic
991944423 5:71885733-71885755 AATTTGCATGTAATTAAAAGTGG - Intergenic
991970706 5:72138820-72138842 AATTTGGGTGTCATTGAAATTGG - Intronic
992354428 5:75966611-75966633 AATTTGCATGTAATTAAAAGTGG + Intergenic
992516310 5:77496766-77496788 AATTTATATGGAATTGCAAGGGG + Intronic
992544379 5:77797010-77797032 AATTTGCATTTTATTTAAAGTGG - Intronic
992675494 5:79101916-79101938 AATTTTGCTGTTATTGAAAGCGG - Intronic
993262869 5:85682631-85682653 AATAAGCATGTAATGGAAAATGG + Intergenic
993298473 5:86175485-86175507 AATTTGCATATAACTAAAAGTGG + Intergenic
993374647 5:87136056-87136078 CATTTGCTTGTAAGTGAAATTGG + Intergenic
993462818 5:88205662-88205684 AACTTGCTTATAGTTGAAAGAGG + Intronic
994238289 5:97391313-97391335 AATTTGCATGTAATTGAAAGTGG + Intergenic
994443698 5:99844149-99844171 AATTTGCATGCAAAGGAAAGAGG - Intergenic
994582935 5:101670712-101670734 AACTTGCAAGTTATTGAAACAGG + Intergenic
994801289 5:104380429-104380451 AATTTGCATATAATTAAAAGTGG + Intergenic
994905527 5:105837761-105837783 AATTTGCATAAAATTAAAAGTGG + Intergenic
995199841 5:109413603-109413625 AATTAGCATATAATTAAAAGTGG - Intergenic
995370474 5:111412893-111412915 AATTTATATGTAATTAAAAGTGG + Intronic
995753578 5:115478027-115478049 AATTGACATGAATTTGAAAGAGG - Intergenic
995840191 5:116436651-116436673 AATCTGCATGCAATTACAAGTGG + Intergenic
995883115 5:116864591-116864613 AGTTTGCATGCAGTTGAAAATGG + Intergenic
995901930 5:117079770-117079792 ATTTTGCATTTAATTAAGAGTGG + Intergenic
996688660 5:126313402-126313424 TATTTCAATGTAATTGAAGGAGG + Intergenic
997065231 5:130551731-130551753 AATTTGCATATAATTAGAAGTGG + Intergenic
997065372 5:130553537-130553559 AATTTGCATGCAATTGAAAGTGG + Intergenic
997065452 5:130554212-130554234 AATTTGCCTGTAAGTGAAAGTGG + Intergenic
997070565 5:130617639-130617661 AATCTGCATGTAGTTAAAAGTGG + Intergenic
997188441 5:131905150-131905172 AATTTCCATTTAATTGTATGGGG - Intronic
999034600 5:148333500-148333522 AATTTGCATATAATTAAAAGTGG - Intronic
999059568 5:148618829-148618851 AATTTGGATTAAATTGACAGTGG - Intronic
999674689 5:153987290-153987312 AATTTGCAGGTAATTAAAAATGG - Intergenic
1000593449 5:163186274-163186296 AATTTGCATGTAATTGAAAGTGG + Intergenic
1000646505 5:163766371-163766393 AATTTGCATATAATCAAAAGTGG - Intergenic
1000651903 5:163829160-163829182 AAACTGCATGTAAGTGACAGGGG - Intergenic
1000728896 5:164806044-164806066 AATTTGCACGTAATTAGAAGTGG - Intergenic
1001356793 5:171034589-171034611 AACATTCATGTAATTCAAAGTGG - Intronic
1001437483 5:171711595-171711617 AATTTGCATATAAATAAAAGTGG - Intergenic
1001881145 5:175245218-175245240 AATTTAAAGTTAATTGAAAGGGG - Intergenic
1003043812 6:2714362-2714384 AATTTGCATGTAATTGAAAGTGG + Intronic
1003069171 6:2931038-2931060 AAGATGCATCTTATTGAAAGAGG - Intergenic
1003787347 6:9501410-9501432 AATTAGCGTGTCATTAAAAGTGG + Intergenic
1004232218 6:13843752-13843774 AATCTGCATGCAATTAAAAGTGG + Intergenic
1004417759 6:15440218-15440240 AATGTGCACTAAATTGAAAGAGG - Intronic
1005431724 6:25764547-25764569 AATTTGGAAGAAATTGAGAGAGG + Intronic
1005567931 6:27115174-27115196 AATTAGCATATAATTAATAGTGG - Intergenic
1006199625 6:32276593-32276615 GATTGGCATATGATTGAAAGTGG - Intergenic
1006417739 6:33914645-33914667 AATTGGCATGTGATCAAAAGTGG + Intergenic
1006722097 6:36162148-36162170 AATTTGCATGTACTTTAAAGTGG + Intergenic
1007144739 6:39616989-39617011 AATTTTCATGGGCTTGAAAGAGG + Intronic
1007366156 6:41395121-41395143 AATTGAGATGTAATTAAAAGAGG + Intergenic
1008206915 6:48671540-48671562 AATTTGCATGTTATTGAAAGTGG - Intergenic
1008579802 6:52896676-52896698 AATTAGCATATAATTGGAAAGGG + Exonic
1008904413 6:56660298-56660320 AGTTTGCAAGGAATTGAAAAGGG + Intronic
1009370474 6:62894350-62894372 AATTTGCATGTAATTGAAAGTGG - Intergenic
1010675919 6:78742778-78742800 AATTTGCATGCAATTGTAAGTGG + Intergenic
1010865959 6:80977004-80977026 ACTATGGATGTACTTGAAAGTGG + Intergenic
1010866611 6:80983363-80983385 ACTTTATATGTAATTAAAAGTGG + Intergenic
1011178600 6:84593097-84593119 AATTTGCATATAATTAAAAGTGG - Intergenic
1011545400 6:88477412-88477434 AATTTACATATAATTGAAAGTGG - Intergenic
1011830012 6:91360390-91360412 AATTTTCATGTAAGTAAAATGGG - Intergenic
1012404135 6:98875437-98875459 AATTGGCATGTAATTGTACCAGG - Exonic
1012665977 6:101970493-101970515 AATTTTCATATAATAAAAAGTGG - Intronic
1012772357 6:103454970-103454992 AACTTGCATGTAATTAAAAGCGG + Intergenic
1013420681 6:109963897-109963919 ATTTTGCATGTAATTAAAAGTGG + Intergenic
1013460959 6:110374869-110374891 AATTTCCATGTAAATCAAATAGG + Intergenic
1013509374 6:110830557-110830579 AATTTGCATGTGATTAAAACTGG + Intronic
1013708268 6:112865374-112865396 AATTAGCATGTCATTAAAAGTGG - Intergenic
1013820743 6:114150898-114150920 ATTTTGCTTGTTCTTGAAAGTGG + Intronic
1013853489 6:114543210-114543232 AATTTCCATGTAAGAGAGAGAGG + Intergenic
1013901897 6:115166754-115166776 ATTTTGTATGTAATAGAATGTGG + Intergenic
1014094260 6:117442758-117442780 AATATACATGTAATTCAAAATGG + Intronic
1014533186 6:122585039-122585061 AATTTGCATATAATTAAAAGTGG + Intronic
1014592332 6:123289674-123289696 AATCTTCATGCAATTGAAAGTGG + Intronic
1014592993 6:123295254-123295276 AATATGCATGCAATTAAAAGTGG + Intronic
1014771373 6:125461260-125461282 AAGTGGCATGTTATTTAAAGTGG - Intergenic
1014916805 6:127160576-127160598 AATTTGCATCTAATTAAAAGTGG - Intronic
1015515490 6:134078860-134078882 AACTCAGATGTAATTGAAAGGGG + Intergenic
1015949750 6:138540149-138540171 AAATTGCATATAATTGTTAGTGG - Intronic
1016053696 6:139556407-139556429 ATTTTGCATCTAATTCATAGTGG + Intergenic
1016519572 6:144931438-144931460 AATTCACATGTAACTGAAAGTGG - Intergenic
1016548059 6:145246361-145246383 AATTTGCATATAATTAAAAGTGG + Intergenic
1017053252 6:150413915-150413937 AATCTGTATGTAATGAAAAGTGG - Intergenic
1017385511 6:153878341-153878363 AGTTTGCATGAAATTAAAAGTGG - Intergenic
1017571156 6:155746068-155746090 AATTTCTAAGTAATTGAAAATGG + Intergenic
1017736489 6:157369520-157369542 AATCTGCATGTAATTAAAAGTGG + Intergenic
1018080237 6:160253296-160253318 AATTTGCATATAATTAAACGTGG - Intronic
1018415623 6:163600024-163600046 AATTTGCATGTAATTAAAGTGGG + Intergenic
1018536367 6:164824918-164824940 AATTTGCATGTGATTAAAAGTGG + Intergenic
1019029083 6:168995021-168995043 AACTTGCATGTAATTAAAAGTGG - Intergenic
1019355747 7:577935-577957 AATGTGCACATAATTTAAAGTGG - Intronic
1019954331 7:4401407-4401429 AATTTGCAGGTAATTAAAAGTGG - Intergenic
1020697240 7:11428710-11428732 AATATGTATGTAATTCAATGGGG - Intronic
1020782034 7:12529926-12529948 AATTTGCATGTAGTTAAAAGTGG - Intergenic
1020856785 7:13437088-13437110 GATTTGTATGTAATTAAAATTGG - Intergenic
1020983276 7:15098700-15098722 AATTAGCTTCTAATTGAAAATGG - Intergenic
1021650430 7:22827826-22827848 AATTTGCATATAATTAAAACTGG + Intergenic
1022007663 7:26281022-26281044 AATTTGCATGTAATTAAAAGTGG + Intergenic
1022299470 7:29089703-29089725 AATCTGCATGTAATTAAAAGTGG + Intronic
1022312079 7:29206600-29206622 TATTTGCATGTACTTGCAACAGG + Intronic
1022687805 7:32612929-32612951 AATTTGCGTATAATTAAAAGTGG - Intergenic
1024187708 7:46970106-46970128 AATTTGCATGTAATTAAAAGTGG - Intergenic
1024405655 7:48976378-48976400 AATCTGCACGTTATTAAAAGTGG - Intergenic
1024435039 7:49342203-49342225 AATTAGCATATAAGTAAAAGTGG + Intergenic
1024652687 7:51419165-51419187 AATTAGCATCTAATTAAGAGTGG - Intergenic
1025037867 7:55609804-55609826 AATTAGCATCTAATTAAGAGTGG - Intergenic
1025164554 7:56701429-56701451 AATTTGTGTGTAATTAAAATTGG + Intergenic
1026128053 7:67596895-67596917 CATTTGAATGTAATTAAAAGGGG - Intergenic
1026357312 7:69569866-69569888 AATTTGCATGTAATTAAAAGTGG - Intergenic
1026535103 7:71232740-71232762 AATTTGCGTGTAATTAAAAGTGG - Intronic
1026664696 7:72332275-72332297 AATTTGCCTGTAACTAAAAGTGG - Intronic
1026674301 7:72416256-72416278 AATTTGCATATAATTAGAAGTGG + Intronic
1026877729 7:73889178-73889200 AATTTGCATATAATTGAAAGTGG + Intergenic
1027127383 7:75566440-75566462 AATTTACATATAATTAAAAGTGG - Intronic
1027337986 7:77174474-77174496 AATTTGCATCTAATTAAAAGTGG - Intronic
1027797194 7:82710504-82710526 AATTTGCATGTAATTAAAAGTGG - Intergenic
1028075064 7:86502498-86502520 AATCTGCATGCAATTAAAAGTGG - Intergenic
1028317903 7:89427039-89427061 AATTTGCACATAATTGAAAGTGG - Intergenic
1028391068 7:90317617-90317639 ATTTTGCATGTAATTTCAGGGGG - Intergenic
1028883455 7:95906118-95906140 ATTTTACATATAATTGAAAAGGG - Intronic
1029161209 7:98553432-98553454 AATTTGCAGGTAATCAAAAGTGG + Intergenic
1029188126 7:98754064-98754086 AATTTGCATATAATTAAAAGTGG - Intergenic
1029197765 7:98818321-98818343 AATTTGCCTATAATTAAACGTGG - Intergenic
1029427655 7:100506617-100506639 AATTTGCATATAATTAAAAATGG - Intergenic
1029577376 7:101412341-101412363 AATTTGCATACAATTAAAAGTGG + Intronic
1029777748 7:102696337-102696359 AATTTGCATCTAATTAAAAGTGG + Intergenic
1029817929 7:103115809-103115831 AATTTACATATAATTAAAAGTGG - Intronic
1030222212 7:107109034-107109056 ATTTAGCATGTAATTAAAAGTGG - Intronic
1030542588 7:110850443-110850465 GATTTACATATAACTGAAAGTGG + Intronic
1030605550 7:111635512-111635534 AATTTGTATGTAACCAAAAGGGG + Intergenic
1030757947 7:113312602-113312624 AATTTAAATGTTAATGAAAGAGG + Intergenic
1030776768 7:113543333-113543355 AATTTGCATATAATTGAAAGTGG + Intergenic
1030900863 7:115121392-115121414 AATTTACATGTAATTTAAAGTGG + Intergenic
1031268598 7:119614919-119614941 AATGTGAATGTAATTTACAGTGG - Intergenic
1031366696 7:120909136-120909158 AATTTGAATGTCATTAATAGAGG - Intergenic
1031668131 7:124510824-124510846 AATTTGCTTGTAACTGAAAGTGG - Intergenic
1031700120 7:124914322-124914344 AATTTGTATGGAATTTCAAGGGG - Intronic
1031805415 7:126301467-126301489 AATTAGCATATAATTAAGAGTGG + Intergenic
1031892328 7:127309138-127309160 AATTTGCATATAATTAAAAGGGG + Intergenic
1033161067 7:138997240-138997262 AATATGCATGTAATTGCTAATGG + Intergenic
1033847184 7:145447956-145447978 AATTTGCCTGTAATTTAAAGTGG + Intergenic
1033865282 7:145683903-145683925 CTTTTGGATGTAATTGAAAAAGG + Intergenic
1034053488 7:148008570-148008592 ATTTTTCATGACATTGAAAGTGG - Intronic
1034110001 7:148527627-148527649 AATTTGCATGTAATTAAAAGTGG - Intergenic
1034383995 7:150722760-150722782 AATTTGCATATAGTTGAAAGTGG - Exonic
1034707339 7:153157299-153157321 AATTTGCATGTAATTAAAAGTGG + Intergenic
1034970604 7:155417049-155417071 AATTTGCATATAATTAAAAGTGG + Intergenic
1034974013 7:155437444-155437466 AATTTGCATATAATTAAAAGTGG - Intergenic
1035967515 8:4209819-4209841 ATTTTGCATGTAATTGAAAGTGG - Intronic
1036137262 8:6173739-6173761 AATCTGCATGCTATTAAAAGTGG + Intergenic
1036378160 8:8218521-8218543 AATCTGCATGCAATTAAAAGTGG + Intergenic
1036552322 8:9826487-9826509 AATTCACATGTAATTGGATGGGG + Intergenic
1036913062 8:12775100-12775122 AATTAGCATATCATTGAAAGTGG + Intergenic
1036940491 8:13047703-13047725 AGGTTGCTTGTATTTGAAAGGGG + Intergenic
1037053512 8:14406785-14406807 AATTTGAAAATAATTAAAAGTGG + Intronic
1037124850 8:15335500-15335522 AATATGCATATAATTAAAAGTGG + Intergenic
1037471466 8:19215443-19215465 AATTTACATATAATTGAAAGTGG + Intergenic
1037530681 8:19769815-19769837 AATTTGCATGTCATTAAAAGTGG + Intergenic
1037715997 8:21400784-21400806 AATTTGCATTTAATTAAAAGTGG - Intergenic
1038375201 8:27033138-27033160 TATTTGCATGCAATTGAAAGTGG - Intergenic
1038448986 8:27626796-27626818 AATTTGCATATAATTAAAAGTGG + Intergenic
1038490925 8:27970531-27970553 AATTTGCATATAATTAAAAATGG + Intronic
1039157656 8:34579716-34579738 AATTTGCATATAATTCAAAGTGG + Intergenic
1039324989 8:36475198-36475220 AATTTGCATGTAATTAAAAGTGG - Intergenic
1039375287 8:37026671-37026693 AATTTGCATATAACTAAAACTGG + Intergenic
1039531983 8:38270787-38270809 AATTTACATGTAAGTAAAAAGGG - Exonic
1040011412 8:42664098-42664120 AATTTGGATGTCATTAAAAGTGG + Intergenic
1040018082 8:42716563-42716585 AATTTGCATATAATTAAAGGTGG - Intronic
1041415639 8:57605260-57605282 AACTTGCCTGAAATTGTAAGAGG - Intergenic
1041499404 8:58523627-58523649 AATTCGCATATAATTAAAAGTGG + Intergenic
1041526015 8:58806762-58806784 AATTTGTTAGTATTTGAAAGAGG - Exonic
1041601696 8:59725426-59725448 AATTTACATGTAATTTCAATAGG + Intergenic
1042025229 8:64415791-64415813 AATTTGCATGCAATTTCAGGGGG + Intergenic
1042156654 8:65851378-65851400 AATTTGCATATAATTAAAAGTGG + Intergenic
1042355038 8:67818231-67818253 AAGGAGCATGTAACTGAAAGTGG - Intergenic
1042746871 8:72118084-72118106 AATTTGCATGTAATAAAAATTGG + Intronic
1043539772 8:81247465-81247487 AATTTATATGTAATTGCAAGGGG + Intergenic
1043654406 8:82643699-82643721 ATTTTGCATGTAATTAAAACTGG - Intergenic
1044071177 8:87762035-87762057 AGTTTGCAAGTAATTCAGAGAGG + Intergenic
1044155685 8:88843590-88843612 AATTTGCATGTAATTAAAGTGGG - Intergenic
1044252422 8:90019482-90019504 AATTTGCAGGCAATTAAAAGTGG - Intronic
1044492982 8:92842610-92842632 AATTTGCATATAATTAAATGTGG - Intergenic
1044564806 8:93651531-93651553 AATTTGCATGTAATTAAAAGTGG - Intergenic
1044567715 8:93683091-93683113 AGATGGCATGTAACTGAAAGTGG - Intergenic
1044685410 8:94821699-94821721 AATCTGCATGCAATTAAAAGTGG + Intronic
1044904665 8:96988365-96988387 AATATGTATGTAGTAGAAAGGGG - Intronic
1045010727 8:97956477-97956499 AATCTGCATGCAGTTAAAAGTGG - Intronic
1045012474 8:97970159-97970181 AACGTGCCTGCAATTGAAAGTGG - Intronic
1045694363 8:104791781-104791803 AATTTACCTTTAAGTGAAAGTGG + Intronic
1045943492 8:107767315-107767337 ATTTTGCATTTAATTAAAAATGG - Intergenic
1046197100 8:110880134-110880156 ATTTTGGATGCTATTGAAAGTGG + Intergenic
1046395644 8:113634797-113634819 GATTTTCATGTAATTGTAAATGG + Intergenic
1046633462 8:116645282-116645304 ATTCTCCATGTAATTGAGAGTGG - Intronic
1047081785 8:121470672-121470694 ATTTTGCATGTTACTGAAAGTGG + Intergenic
1047173872 8:122521985-122522007 AATTTGCATGTAGATAGAAGAGG - Intergenic
1047534155 8:125704023-125704045 AATTTGCTTGTTACTAAAAGTGG - Intergenic
1048468841 8:134689256-134689278 AATTAGCACGTCATTGAAAGTGG + Intronic
1048742332 8:137575092-137575114 AATTTCCATATTATTAAAAGTGG - Intergenic
1048877686 8:138850017-138850039 ACTTTCCTAGTAATTGAAAGCGG + Intronic
1048938322 8:139375397-139375419 AATTAGCATGTCATTAAAAGTGG - Intergenic
1049253511 8:141601888-141601910 AATCTGCATGCAGTTAAAAGTGG + Intergenic
1049429644 8:142554603-142554625 AATTTGCATACGATTAAAAGTGG - Intergenic
1049627375 8:143631371-143631393 AATTTGCATATGATTAAAAGTGG - Intergenic
1049678623 8:143905011-143905033 AATTTGCATGTAAGTAAAAGTGG + Intergenic
1050154429 9:2650781-2650803 AACTTGCAGGTAATTAAATGAGG + Intronic
1050291255 9:4157379-4157401 ATTTTGCATGTAGTTGAAAAAGG + Intronic
1050620365 9:7445953-7445975 AATTTGCATGTAATTAAAAATGG - Intergenic
1050987674 9:12103579-12103601 AATTTGCAAGATATTTAAAGGGG - Intergenic
1050991896 9:12166592-12166614 ACTTTGCATGTAATCAAAAGTGG - Intergenic
1050993066 9:12176037-12176059 AATCTGCATGTAATTAAAAGTGG - Intergenic
1051011156 9:12416205-12416227 AATTTGCATGTAATTGAAAATGG - Intergenic
1051757281 9:20416568-20416590 TATATGCATGTAATTAAAAAAGG - Intronic
1051938667 9:22476431-22476453 AATTTTTATGGAATTGCAAGAGG - Intergenic
1051988792 9:23125296-23125318 AATTTTAACGTAATTGGAAGAGG - Intergenic
1052131646 9:24855619-24855641 AATTTGCACATAATTTAAAGTGG + Intergenic
1052523503 9:29582599-29582621 GATTTTCAAGTAATTGAAATGGG - Intergenic
1052565162 9:30140482-30140504 AATTAGCATATAATTAAGAGTGG + Intergenic
1052618852 9:30879279-30879301 AATTTACATGGAATTAAAAGAGG - Intergenic
1052856679 9:33411232-33411254 AATCTGCATACAATTAAAAGTGG + Intergenic
1053125138 9:35574975-35574997 AATTTGCATGTAGTTAAAAGTGG + Intergenic
1053228578 9:36385009-36385031 ACTTCGCATGTAGTTGTAAGAGG - Intronic
1053538957 9:38953923-38953945 AATTTGTATGTCATTCAAAGTGG + Intergenic
1053747275 9:41211448-41211470 AATTTAAATTTAAATGAAAGAGG + Intergenic
1054339056 9:63838757-63838779 AATTTAAATTTAAATGAAAGAGG - Intergenic
1054480011 9:65653912-65653934 AATTTAAATTTAAATGAAAGAGG - Intergenic
1054627183 9:67409996-67410018 AATTTGTATGTCATTCAAAGTGG - Intergenic
1055033793 9:71796635-71796657 GATTTGCATGTAATTTAAAGTGG + Intronic
1055917924 9:81425804-81425826 AATTTGCATGTGATTTCATGGGG - Intergenic
1056444466 9:86652446-86652468 AATCTGCATGCAATTAAAAGTGG - Intergenic
1056618659 9:88191418-88191440 ATTTTGCATGTAATTAAAAGTGG - Intergenic
1058194592 9:101956917-101956939 AATTAGCATGTCATTAAAAGTGG + Intergenic
1058331789 9:103770547-103770569 AATTGTCATGTAAATGAAACTGG + Intergenic
1058426320 9:104877972-104877994 AATTTCCATGAAATTGCAATTGG + Intronic
1058431115 9:104920302-104920324 AATATGCATATAATTGTCAGTGG - Intronic
1058489120 9:105476921-105476943 AATTTGAACCTAAATGAAAGTGG + Intronic
1058681132 9:107441182-107441204 TATTTCCATGTTATTGAATGTGG - Intergenic
1059420560 9:114188192-114188214 AATTTGCATATAATTAAAGGTGG - Intronic
1059563158 9:115354963-115354985 AATTCTCATGTAGTTGTAAGAGG - Intronic
1059689309 9:116669243-116669265 AATTTGCATGTAATTAAAAGTGG + Intronic
1059978388 9:119742702-119742724 AATTTGCATATAATTAAAAGTGG + Intergenic
1060424383 9:123492477-123492499 AATGTGAAGGGAATTGAAAGTGG + Intronic
1060429621 9:123539337-123539359 AAATTGTAAGTAAATGAAAGGGG + Intronic
1060833049 9:126731330-126731352 AATTAGCATTTAATTGTAAAAGG - Intergenic
1061224541 9:129273126-129273148 AATTTGCATATAATTAAAAGTGG + Intergenic
1061853131 9:133427813-133427835 AATTTGCATATAATTAGAAGTGG - Intronic
1062078735 9:134607286-134607308 GATTTGCATATAATTAAAATGGG - Intergenic
1062131231 9:134894493-134894515 AATTTGCATTTAGTTAAAAGTGG + Intergenic
1202783407 9_KI270718v1_random:22227-22249 AATTTAAATTTAAATGAAAGAGG + Intergenic
1202803627 9_KI270720v1_random:27143-27165 AATTTAAATTTAAATGAAAGAGG - Intergenic
1185562873 X:1073064-1073086 CATTTGCATGTAATTAGCAGCGG + Intergenic
1185682370 X:1899095-1899117 CATTTGCATGTAATTAGCAGTGG - Intergenic
1185803459 X:3034544-3034566 AATCTGCATGCAATTAAAAGTGG - Intergenic
1185811616 X:3115578-3115600 AATCTGCATGCAATTAAAAATGG + Intergenic
1185857601 X:3550482-3550504 AATTTGCATGCCATTAGAAGTGG + Intergenic
1185928961 X:4180802-4180824 AAAATGAATTTAATTGAAAGTGG + Intergenic
1186010414 X:5125438-5125460 AATTTGCATGTTATTAAGAGTGG + Intergenic
1186045694 X:5534211-5534233 AATCTGCATGTAATTAAAAGTGG + Intergenic
1186160650 X:6773829-6773851 AATCTGCAGGAAATTAAAAGTGG + Intergenic
1186536873 X:10359158-10359180 AATTTGCATGTAATTAAAAGTGG - Intergenic
1186604116 X:11071071-11071093 ATTTTGCATATAATTAAAAGTGG + Intergenic
1186668678 X:11746316-11746338 AATTTGTATGGAAATGAAAAGGG - Intergenic
1187001853 X:15189198-15189220 AATCTGCATATAATTGATAACGG - Intergenic
1187045131 X:15640302-15640324 AATCTACATGTAATTAAAAGTGG + Intronic
1187096475 X:16153983-16154005 AATTTGAATTTATTTGAAAGTGG - Intergenic
1187484596 X:19690658-19690680 AATATGTATGAAATTGAAATTGG + Intronic
1188672634 X:32898562-32898584 AATTTACATGTAATTGAAAGTGG - Intronic
1188928161 X:36070943-36070965 AATCTGCATGCAATTAAAAATGG + Intronic
1189835878 X:45022197-45022219 AAATTCCATTTAAATGAAAGTGG + Intronic
1190364632 X:49680082-49680104 AATTTGCATGTGATTGAAAGTGG - Intergenic
1190500526 X:51072625-51072647 AATTCCCATGGAATTGTAAGGGG + Intergenic
1190504926 X:51118126-51118148 AATTCCCATGGAATTGTAAGTGG - Intergenic
1190554761 X:51623055-51623077 AATTTGCAGGTAATTGAAAGAGG - Intergenic
1190628404 X:52359955-52359977 AATATACACGTAATTGAAAGTGG + Intergenic
1190682068 X:52834972-52834994 CATTTACATGGAACTGAAAGTGG - Intergenic
1190953323 X:55167480-55167502 AATGTACATATAATTGAAAGTGG + Intronic
1191183801 X:57589140-57589162 AATTTAAATGGAATTGAAATGGG + Intergenic
1192416815 X:70988492-70988514 AATTTGCATGTAACTGAAAGTGG - Intergenic
1193235446 X:79100981-79101003 AATCTACATGTACTTTAAAGTGG + Intergenic
1193824918 X:86212676-86212698 AATTTACATGTAGTTTATAGTGG - Intronic
1193835897 X:86343282-86343304 AATTTACAAGTTATCGAAAGTGG + Intronic
1193872797 X:86822503-86822525 AATTTGCTTGCCATTGACAGTGG + Intronic
1194107618 X:89791729-89791751 AATTTACAAATAATTGAAACAGG + Intergenic
1194152784 X:90345671-90345693 AATTTGCATGTAATCGTAAGTGG - Intergenic
1194221693 X:91200762-91200784 AATATACATGGAATTGAAATGGG - Intergenic
1194334958 X:92634235-92634257 ACTTTTCATGTAGTTGTAAGAGG + Intergenic
1194388762 X:93290133-93290155 ACTTTTCATGTAGTTGTAAGAGG + Intergenic
1194479944 X:94409164-94409186 AATTTGTATATCATTGAAAGCGG - Intergenic
1194570892 X:95553448-95553470 AATTTGCATATAATTAAATGTGG - Intergenic
1194571824 X:95561880-95561902 AATTTGCATATAATTAAATATGG - Intergenic
1194644717 X:96445289-96445311 AATCTGCATTTATTTGAAATCGG + Intergenic
1194679000 X:96828729-96828751 GATTTGCCTGGTATTGAAAGGGG - Intronic
1195025841 X:100876776-100876798 AATTTACATGAAAATGAAAAAGG - Intergenic
1195092038 X:101469929-101469951 AATTTGCGTATAATTAAAAGTGG + Intronic
1195267893 X:103201215-103201237 AATTTGCATGTAACTAAAGGTGG + Intergenic
1195268840 X:103211367-103211389 AATTTGTGTGTAATTGAAAGTGG + Intergenic
1195296597 X:103484489-103484511 AATATTTGTGTAATTGAAAGAGG + Intergenic
1195373925 X:104207039-104207061 AATTTGCATGTAATTGAAAGTGG - Intergenic
1195389216 X:104343663-104343685 AATTTGCATGTAATTGAAAGTGG - Intergenic
1195446127 X:104955002-104955024 AATTTGCATATAATTAAAACTGG - Intronic
1195447415 X:104970502-104970524 AATTTGCACATAATTAAAAGTGG - Intronic
1195448254 X:104977834-104977856 AATTTGCATATAATAAAACGTGG - Intronic
1195539976 X:106052595-106052617 AATTTGCATATAATTAAATGTGG - Intergenic
1196064673 X:111450373-111450395 AATTAGTATGGAATTGCAAGGGG + Intergenic
1197131527 X:123010788-123010810 CATTTGCAGAAAATTGAAAGTGG + Intergenic
1197469304 X:126848335-126848357 AATCTTCATATGATTGAAAGGGG + Intergenic
1197895598 X:131310516-131310538 AATTTGCATTTTATTAAAATCGG + Intronic
1198175285 X:134148636-134148658 AATCTGCATGCAATTAAAAGTGG + Intergenic
1198237946 X:134753826-134753848 CATCTGCAGGTAATTGAAACAGG + Intronic
1198271344 X:135059048-135059070 AATTTGCATGTAATTAAAAGTGG + Intergenic
1198272696 X:135069209-135069231 AATTTGCATGCAATTAAAAGTGG + Intergenic
1198759780 X:140019188-140019210 AATTTGAATATAATTAAAAGTGG - Intergenic
1198779005 X:140214862-140214884 AATTTGAATATAATTAAAAGTGG + Intergenic
1198846592 X:140918770-140918792 AATTTGCATATAATTAAAAGTGG + Intergenic
1200385430 X:155885582-155885604 AATTAAGATGTAATTGAAAATGG + Intronic
1200459574 Y:3439514-3439536 AATTTACAAATAATTGAAACAGG + Intergenic
1200499128 Y:3922416-3922438 AATTTGCATGTAATCGTAAGTGG - Intergenic
1200558210 Y:4664518-4664540 AATATACATGGAATTGAAATGGG - Intergenic
1200643436 Y:5751286-5751308 ACTTTTCATGTAGTTGTAAGAGG + Intergenic
1201269682 Y:12242731-12242753 AATCTGCATGCAATTAAAAATGG - Intergenic