ID: 1144424864

View in Genome Browser
Species Human (GRCh38)
Location 17:15132318-15132340
Sequence ATGTAATTGAAAGTGGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144424857_1144424864 -6 Left 1144424857 17:15132301-15132323 CCCACCCCTTAATTTGCATGTAA 0: 19
1: 56
2: 74
3: 113
4: 282
Right 1144424864 17:15132318-15132340 ATGTAATTGAAAGTGGGCTTAGG No data
1144424856_1144424864 10 Left 1144424856 17:15132285-15132307 CCTCAATTTGAATTGACCCACCC No data
Right 1144424864 17:15132318-15132340 ATGTAATTGAAAGTGGGCTTAGG No data
1144424858_1144424864 -7 Left 1144424858 17:15132302-15132324 CCACCCCTTAATTTGCATGTAAT 0: 32
1: 80
2: 128
3: 239
4: 651
Right 1144424864 17:15132318-15132340 ATGTAATTGAAAGTGGGCTTAGG No data
1144424859_1144424864 -10 Left 1144424859 17:15132305-15132327 CCCCTTAATTTGCATGTAATTGA 0: 23
1: 105
2: 207
3: 313
4: 484
Right 1144424864 17:15132318-15132340 ATGTAATTGAAAGTGGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144424864 Original CRISPR ATGTAATTGAAAGTGGGCTT AGG Intergenic
No off target data available for this crispr