ID: 1144425027

View in Genome Browser
Species Human (GRCh38)
Location 17:15133582-15133604
Sequence CACTGTGAGGCGGGAGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 3, 2: 8, 3: 67, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144425027 Original CRISPR CACTGTGAGGCGGGAGAATA GGG (reversed) Intergenic
900682116 1:3922681-3922703 CAAAGTGAGGCAGGAGAATAGGG - Intergenic
901327269 1:8374768-8374790 GGCCGTGAGGCGGGGGAATATGG - Intronic
901775722 1:11559446-11559468 CACTGGGGTGCAGGAGAATAGGG + Intergenic
901945928 1:12703593-12703615 CACTGAGAGGAGAGACAATACGG - Intergenic
902032734 1:13434537-13434559 GGCAGTGAGGCAGGAGAATAGGG + Intergenic
903163122 1:21503352-21503374 CAGGCTGAGGCGGGAGAATCAGG + Intergenic
904499959 1:30908095-30908117 CACTGGGAGGTGGGGGAACAGGG + Intronic
904950666 1:34236022-34236044 CATAGTGAGGCAGGAGAATAGGG + Intergenic
905482848 1:38273443-38273465 CGCTGTGAAGCGGGAGAACGTGG - Intergenic
906194273 1:43920300-43920322 GACAGTGAGGCGGGAGCATGAGG - Intronic
906845872 1:49191268-49191290 CACGGTGTGGTGGGAGAATCTGG - Intronic
908116007 1:60940972-60940994 GAATGTGAGGCAGGAGAATAGGG - Intronic
908542945 1:65138712-65138734 CATTTTGAGGCAGGAGAATAGGG - Intergenic
908934975 1:69363715-69363737 AATTGTGAGCCAGGAGAATAGGG - Intergenic
910734987 1:90443737-90443759 TACTGTGAGGCGGGAGAATAGGG - Intergenic
911253673 1:95609481-95609503 CACTGTGAGACTGGAGAAGATGG + Intergenic
911283309 1:95958505-95958527 CAGTGTGAGGGGGTAGTATAGGG - Intergenic
912435943 1:109661144-109661166 CCCTGAGAGGGGGGAAAATAAGG - Exonic
912437885 1:109674726-109674748 CCCTGAGAGGGGGGAAAATAAGG - Exonic
912440396 1:109693185-109693207 CCCTGAGAGGGGGGAAAATAAGG - Exonic
912751539 1:112292682-112292704 CAGGCTGAGGCGGGAGAATCAGG - Intergenic
912882471 1:113429888-113429910 TATGGTGAGGCAGGAGAATAGGG - Intronic
913062770 1:115223248-115223270 CACTGTGAGTAGGGAAAATTTGG - Intergenic
913240507 1:116825881-116825903 CCCTGAGAGGTGGGAGAAGAGGG - Intergenic
913282229 1:117197384-117197406 AAATTTGAGGCAGGAGAATAGGG + Intronic
915489927 1:156245237-156245259 AACTGGGAGGCGGGAGGAAAAGG + Exonic
917351005 1:174077668-174077690 CCCATTGAGGCAGGAGAATAGGG + Intergenic
919621191 1:199866245-199866267 CAAATTGAGGCAGGAGAATAGGG - Intergenic
920439800 1:205972433-205972455 CACTGTGATAAGGGAGAGTAGGG + Intergenic
921169416 1:212533233-212533255 CAGTATGAGGCAGGAGAATAGGG + Intergenic
921982736 1:221275755-221275777 CTTGGTGAGGCAGGAGAATAGGG + Intergenic
922273854 1:224058417-224058439 TCCTGTGAGGCAGGAAAATAGGG - Intergenic
922371928 1:224919930-224919952 GAATTTGAGGCAGGAGAATAGGG - Intronic
922968996 1:229718267-229718289 CCAGGTGAGGCAGGAGAATAGGG - Intergenic
923633203 1:235669273-235669295 CCTGGTGAGGCAGGAGAATAGGG + Intronic
923939640 1:238807213-238807235 AACTGTGAGCTGGCAGAATAGGG + Intergenic
924692121 1:246362561-246362583 CAGGCTGAGGCGGGAGAATCAGG - Intronic
924789163 1:247228140-247228162 CATTCTGAGGCAGGAGACTAGGG + Intergenic
924830509 1:247589087-247589109 CACTGTCAGGTGGGAGAAGCAGG - Exonic
1063910830 10:10828503-10828525 CACTGTGTGTGGGGAGAATGGGG + Intergenic
1064152612 10:12877306-12877328 CATTGTGAGGCAGGAGAAAAAGG + Intergenic
1064351935 10:14584645-14584667 CCCTGTGAGGCAGGAGAATAGGG + Intronic
1064408443 10:15084993-15085015 CAGGATGAGGCAGGAGAATAGGG - Intronic
1064745817 10:18477193-18477215 TATTATGAGGCAGGAGAATAGGG - Intronic
1065095710 10:22278662-22278684 CACCATGAGGCGGGAAAATAGGG - Intergenic
1065153599 10:22847520-22847542 AAAAGTGAGGCAGGAGAATAGGG - Intergenic
1066270330 10:33816212-33816234 GCCTTTGAGGCAGGAGAATAGGG - Intergenic
1067246274 10:44549132-44549154 CCCTTTGAGGCAGGAGAATAGGG + Intergenic
1068028565 10:51679666-51679688 GATAGTGAGGCAGGAGAATAGGG + Intronic
1069485117 10:68817418-68817440 TACTGTGTGGCGGGAGCATGAGG + Intergenic
1071546299 10:86532364-86532386 CCCAGTGAGGCAGGAAAATATGG + Intergenic
1072279885 10:93856208-93856230 GGCTGTGAGGCAGGAGAATGGGG - Intergenic
1075155550 10:119973660-119973682 AGCTTTGAGGCAGGAGAATAGGG - Intergenic
1075538720 10:123294571-123294593 CCCTGTGAGGAAGGACAATATGG + Intergenic
1076466094 10:130682587-130682609 CACTGTCATGTGGGAGAAAATGG + Intergenic
1076908404 10:133374682-133374704 CATAGTGAGGCAGGAGAACAGGG - Intergenic
1079742168 11:24076400-24076422 GAATGTGAGGCAGGAGAATAGGG - Intergenic
1079988064 11:27218785-27218807 CCCTGTGAGGCAGGAGAATAGGG + Intergenic
1080892772 11:36423875-36423897 CACTGTGAGGGGCGAGAATGAGG + Intronic
1081669365 11:44934633-44934655 CACTGTGAGGGTGAAGAACAGGG + Exonic
1082894771 11:58178453-58178475 CACAGTGAGGAGGAAGAATTTGG + Intronic
1082937639 11:58670866-58670888 CCTTTTGAGGCAGGAGAATAGGG - Intronic
1084082861 11:66840384-66840406 CACTGTGAGCCTGGAGGAAATGG - Intronic
1084198396 11:67539425-67539447 CCTGGTGAGGCAGGAGAATAGGG + Intergenic
1085159526 11:74327906-74327928 CAGGCTGAGGCGGGAGAATCAGG - Intergenic
1086341392 11:85852474-85852496 CAGGCTGAGGCGGGAGAATCAGG - Intergenic
1086430371 11:86731666-86731688 CAGGCTGAGGCGGGAGAATCAGG - Intergenic
1086434979 11:86771363-86771385 CAGGCTGAGGCGGGAGAATCAGG + Intergenic
1088278695 11:108115809-108115831 AATTCTGAGGCAGGAGAATAGGG + Intergenic
1089458683 11:118640456-118640478 AACTGTGGGTCGGGAGGATAGGG - Intronic
1090100977 11:123796519-123796541 CCCACTGAGGCAGGAGAATAGGG - Intergenic
1090907048 11:131085041-131085063 CAGGCTGAGGCAGGAGAATAAGG + Intergenic
1092251540 12:6901126-6901148 GGCTGAGAGGCAGGAGAATAGGG - Intronic
1094027690 12:25976091-25976113 GCCAGTGAGGCAGGAGAATAGGG + Intronic
1094555383 12:31494407-31494429 CATTATGAGGCAGGAGAACAGGG + Intronic
1094666668 12:32526960-32526982 TACTGTTAGCTGGGAGAATATGG - Intronic
1095214989 12:39537929-39537951 CAGAATGAGGCAGGAGAATAGGG + Intergenic
1096131246 12:49160608-49160630 CTCACTGAGGCAGGAGAATAGGG + Intergenic
1097424030 12:59419559-59419581 CATATTGAGGCAGGAGAATAGGG + Intergenic
1097479218 12:60100088-60100110 AAAGGTGAGGCAGGAGAATAGGG - Intergenic
1098135532 12:67397813-67397835 AATGGTGAGGCAGGAGAATAGGG - Intergenic
1098313334 12:69169219-69169241 GCTTGTGAGGCAGGAGAATAGGG + Intergenic
1099572976 12:84348613-84348635 CACTGTGAGGGGTGAGACTTGGG - Intergenic
1100257277 12:92897066-92897088 ACCAGTGAGGCAGGAGAATAGGG + Intronic
1100661073 12:96699372-96699394 AAGTATGAGGCAGGAGAATAGGG - Intronic
1103326468 12:120124654-120124676 CACTGTGATGCGGGAGGACTTGG - Intergenic
1103500020 12:121394466-121394488 CACTTTCAGGCAGGAGAACAGGG - Intronic
1103926442 12:124426078-124426100 CACTGCGAGTCGGAAGAACAAGG - Intronic
1104258560 12:127161553-127161575 CATTTTGAGGCAGGAAAATAGGG - Intergenic
1106784851 13:33096445-33096467 CAGTCTGAGGCAGGAGAAGATGG + Intergenic
1107115926 13:36745475-36745497 CACTGTGAGGAGTGAGCAGAGGG - Intergenic
1107517892 13:41149609-41149631 CACTGAGAGGCTGAAGAAAAAGG - Intergenic
1108180524 13:47835814-47835836 TCTTGTGAGGCAGGAGAATAGGG + Intergenic
1108370186 13:49761339-49761361 CAGGCTGAGGCGGGAGAATCAGG - Intronic
1109036785 13:57273049-57273071 CACTGAAAGGTGGGGGAATAAGG + Intergenic
1110524418 13:76519541-76519563 CATACTGAGGCAGGAGAATAGGG + Intergenic
1110606397 13:77437967-77437989 TACTGTGGGGTGGGAGGATAGGG - Intergenic
1110964644 13:81677674-81677696 TTGTGTGAAGCGGGAGAATAAGG + Intergenic
1111515407 13:89324741-89324763 GAGGGTGAGGCAGGAGAATAGGG + Intergenic
1111940228 13:94600305-94600327 GAAAGTGAGGCAGGAGAATAGGG - Intergenic
1112370480 13:98788781-98788803 CCCAGTGAGGCAGGAAAATAGGG + Intergenic
1112638574 13:101245660-101245682 CATAATGAGGCAGGAGAATAGGG + Intronic
1112816537 13:103279643-103279665 CACTGGGAGGTGGTAGAATGAGG - Intergenic
1112921198 13:104614843-104614865 GGCAGTGAGGCAGGAGAATAGGG + Intergenic
1115359038 14:32481261-32481283 AACTGTGAGGCAGGAGAATAGGG - Intronic
1116801587 14:49449870-49449892 CATTCTGAGGCAGGAGAATAGGG - Intergenic
1116991055 14:51276946-51276968 AATTGTGAGGCAGGAGAATAGGG - Intergenic
1120232680 14:81856920-81856942 CACCTTGAGGCAGGAAAATAGGG - Intergenic
1120429536 14:84397937-84397959 GACTGAGAGCCAGGAGAATAAGG - Intergenic
1120547738 14:85830526-85830548 CAGTCTGAGGCAGGAGAATAAGG + Intergenic
1121435548 14:93916906-93916928 GAGCGTGAGGCAGGAGAATAGGG - Intergenic
1121653537 14:95577469-95577491 CCCTGTGAGGCAGGAGAATAGGG - Intergenic
1122647553 14:103205560-103205582 CACTGTGAGGCAGGAAATTAAGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1125931532 15:43603667-43603689 CATTGTGAGGCTGGAGAACTGGG - Intronic
1127774867 15:62256667-62256689 CTCTATGAGGCAGGAAAATAAGG + Intergenic
1127775461 15:62260893-62260915 CTCTATGAGGCAGGAAAATAGGG + Intergenic
1128004384 15:64225256-64225278 GCCTCTGAGGCAGGAGAATAGGG + Intronic
1129200712 15:73997311-73997333 GATTCTGAGGCAGGAGAATAGGG - Intronic
1129261532 15:74370830-74370852 CACATTGAGGCAGGAGAATAGGG + Intergenic
1130311973 15:82764129-82764151 CCCTGTGAAGCAGGAGAACAGGG + Intronic
1131005389 15:88973297-88973319 CCCACTGAGGCAGGAGAATAGGG - Intergenic
1131951303 15:97684120-97684142 CCTTTTGAGGCAGGAGAATAGGG - Intergenic
1132145381 15:99426206-99426228 CACTCTGAGGTGGAAGAACAAGG - Intergenic
1132239749 15:100248654-100248676 CACTGTAAGGCAGGAGGATCTGG - Intronic
1133099096 16:3468404-3468426 CACTGTGAGGCAGGAGAATAGGG - Intronic
1134226855 16:12397963-12397985 CAATTTGAGGCAGCAGAATATGG - Intronic
1134280439 16:12812312-12812334 CATGGTGAGGCAGGAGAAGAGGG - Intergenic
1134777598 16:16866522-16866544 CACAGTGAGGCAGAAGAACAAGG + Intergenic
1134777721 16:16867484-16867506 CACAGTGAGGCAGAAGAACAAGG - Intergenic
1135123329 16:19785397-19785419 GCCAGTGAGGCAGGAGAATAGGG + Intronic
1135694674 16:24575658-24575680 CAGGCTGAGGCGGGAGAATCAGG + Intergenic
1137598157 16:49738488-49738510 CACTGTGAGGTTGGAGAGGATGG - Intronic
1137917756 16:52451552-52451574 CACTGTGAGTCAAGAGAATTTGG - Intronic
1138129253 16:54465494-54465516 GATAGTGAGGCAGGAGAATACGG - Intergenic
1138540260 16:57683665-57683687 CAATGTGAGGCAGGATAATAGGG - Intronic
1139365935 16:66433646-66433668 CACTGTGACTCAGAAGAATAAGG - Intronic
1139669850 16:68485274-68485296 CACTGTGGGGAGCTAGAATAAGG + Intergenic
1140115002 16:72034269-72034291 CCCAGTAAGGCAGGAGAATAGGG + Intergenic
1141004901 16:80343024-80343046 CACTGTGAGGCCCGTGAAAATGG + Intergenic
1141089105 16:81117683-81117705 CCCATTGAGGCGGGATAATAGGG + Intergenic
1142048218 16:87939902-87939924 CTACCTGAGGCGGGAGAATAGGG - Intergenic
1142949059 17:3464081-3464103 CAGGGTGAGGCAGGAGAATCAGG - Intronic
1143008685 17:3853751-3853773 CAGGGTGAGGCAGGAGAATCAGG - Intergenic
1143277351 17:5721796-5721818 CAGGGTGAGGCAGGAGAATCAGG + Intergenic
1143913217 17:10269292-10269314 CACTGTGAGAAGGGAGACTCTGG - Intergenic
1144425027 17:15133582-15133604 CACTGTGAGGCGGGAGAATAGGG - Intergenic
1144635954 17:16909329-16909351 CATACTGAGGCAGGAGAATAGGG + Intergenic
1144754648 17:17671709-17671731 CACCGTGAGGAGGGTGAATGGGG + Intergenic
1144951030 17:18993537-18993559 CATAGTGAGGAGAGAGAATATGG - Intronic
1146948398 17:36889709-36889731 TTCTGTGAGCAGGGAGAATATGG + Intergenic
1149271287 17:54980772-54980794 CCTTGTGAGGCAGGAGAATAGGG - Intronic
1149451406 17:56752610-56752632 CCCTTTGAGGCAGGAGAATAGGG + Intergenic
1149630785 17:58120684-58120706 CACTGTAAAGCTGAAGAATAGGG + Intergenic
1151633301 17:75326133-75326155 CACTGTGAGGCTGGAGGATGAGG - Intronic
1152647955 17:81478669-81478691 GAGGCTGAGGCGGGAGAATAGGG + Intergenic
1152833199 17:82511724-82511746 GCCTGTGAGGCAGAAGAATAGGG - Intergenic
1153468852 18:5419797-5419819 CACTGTGACTCCGGAGAAGAAGG - Exonic
1153721758 18:7910916-7910938 CAGAGTAAGTCGGGAGAATAGGG - Intronic
1153832141 18:8933251-8933273 CATTGTGAGGCAGGAGAATAGGG + Intergenic
1155185981 18:23386863-23386885 CAAGGTGAGGGGGGAGAATGAGG + Intronic
1155198969 18:23501193-23501215 CACTGTGTGGCTGGAGAGCAGGG + Intergenic
1155462920 18:26103679-26103701 TCTTGTGAGGCAGGAGAATAGGG + Intergenic
1158266315 18:55664494-55664516 CACTTTGAAGCAGGAGAATAGGG + Intronic
1158684764 18:59603406-59603428 CCCTGTGAGGAGGCAGAATTTGG + Intronic
1159208059 18:65279574-65279596 CAGCTTGAGGCAGGAGAATAGGG - Intergenic
1159239489 18:65723604-65723626 CATTTTGAGGAAGGAGAATAGGG + Intergenic
1159468822 18:68822843-68822865 ATATGTGAGGCAGGAGAATAGGG + Intronic
1160194707 18:76742958-76742980 CACTGTGAGGCTGGAGGATGAGG + Intergenic
1160294132 18:77622394-77622416 CTCTGTGAGGCAGGAGAATAGGG - Intergenic
1161181266 19:2884346-2884368 CATTTTGAGGCAGGAGAATAGGG - Intergenic
1161186883 19:2927058-2927080 CAGGGCGAGGCGGGAGATTACGG + Intergenic
1162602275 19:11677771-11677793 CAGTCTGAGGCAGGAGAATGAGG + Intergenic
1166713202 19:44950307-44950329 AACTGTAAGGCAGGAAAATAGGG - Intronic
1166952926 19:46442214-46442236 CACATTGAGGCAGGAGAATAGGG + Intergenic
1168425183 19:56234414-56234436 GGCTCTGAGGCAGGAGAATAGGG + Intronic
1168628322 19:57936340-57936362 CAGAGTGAGGCAGGAGAATAGGG - Intergenic
1168658148 19:58146651-58146673 CAGGCTGAGGCGGGAGAATCAGG - Intronic
1168673276 19:58257707-58257729 GCCAGTGAGGCAGGAGAATAGGG - Intronic
1168724854 19:58575509-58575531 CACTGTGAGGCGGGGCGATGGGG + Intergenic
924973424 2:152054-152076 CATTTTGAGGTAGGAGAATAGGG + Intergenic
926042649 2:9686460-9686482 CCAGGTGAGGCAGGAGAATACGG - Intergenic
928453239 2:31397586-31397608 CACTGTGGGGAGGGAGACCAAGG - Intronic
932039462 2:68283829-68283851 CTCTGTGTGGCTGGAGCATAGGG - Intergenic
932099885 2:68889219-68889241 CACTGTGAAGCTGAAGAATCTGG + Intergenic
933079867 2:77972412-77972434 CATTGCGAGGCAGGAGAATAGGG - Intergenic
936110410 2:109659997-109660019 CCCAGTGAGGCAGGAGAATAAGG + Intergenic
938236220 2:129709110-129709132 GGCTGTGAGGCAGGAGAATAGGG - Intergenic
940377495 2:152972078-152972100 CCCTGTGAGGCAGGGGAATAGGG - Intergenic
940722530 2:157298102-157298124 GGTTGTGAGGCAGGAGAATAGGG + Intronic
941749278 2:169118408-169118430 CATTGTGAGGCAGGAGAATTGGG - Intergenic
942016942 2:171827354-171827376 CATTTTTAGGCAGGAGAATAGGG + Intronic
942676263 2:178429523-178429545 CACTGGGTGGAGGAAGAATATGG + Intergenic
942957378 2:181788945-181788967 CACTGTGAGGCCTGAAAAAAAGG + Intergenic
943323294 2:186472349-186472371 CAGTCTGAGGCAGGAGAATCAGG - Intergenic
943847477 2:192670237-192670259 TACTGTGAGGCAGGAGAATAGGG - Intergenic
944340851 2:198597102-198597124 GACTGTGAGGCTGGAAAAGATGG - Intergenic
944446101 2:199791262-199791284 CACTGAGAGGGGGAAGAAAAAGG + Intronic
944485758 2:200203455-200203477 CACACTGAGGCAGGAGAGTAAGG + Intergenic
944570704 2:201042057-201042079 CAGTCTGAGGCAGGAGAATCAGG - Intronic
945063873 2:205931900-205931922 GACACTGAGGCAGGAGAATAGGG - Intergenic
946466068 2:219913284-219913306 CACTGTGTGGTTGGAGAACAAGG - Intergenic
946745105 2:222837653-222837675 CACAGTGAGGGTGGAGAAGAGGG - Intergenic
947302896 2:228707946-228707968 TGCTGTGAGGCGGCAGAAAAGGG - Intergenic
947497879 2:230651884-230651906 GGGTGTGAGGCGGGAGAATAGGG - Intergenic
947539914 2:230969240-230969262 CACTTTGAGGCAGGAGACTAGGG + Intergenic
947882580 2:233531891-233531913 CCCAGTGAGGCAGGAGAATAGGG + Intronic
947919452 2:233856558-233856580 CATGGTGAGGCAGGAGAATAGGG - Intergenic
948075483 2:235162420-235162442 CATTTTGGGGCAGGAGAATAGGG - Intergenic
1169449734 20:5701452-5701474 CAGGCTGAGGCGGGAGAATCAGG - Intergenic
1170296201 20:14829093-14829115 CACTGTGGGGCGGGGGAGCAGGG - Intronic
1172175844 20:32971253-32971275 CCCAGTGAGGCAGGAAAATAGGG + Intergenic
1172516688 20:35539740-35539762 CACTATGAGGCAGGAGAACAGGG + Intergenic
1173699685 20:45057562-45057584 GACTGGGAGAGGGGAGAATAGGG - Intronic
1173959986 20:47063436-47063458 GACAGTGAGGCAGGAGAATAGGG + Intronic
1174133999 20:48366294-48366316 CACGGTGTGTCGGGAGAAGATGG + Intergenic
1174157510 20:48525424-48525446 CATAGTGAGGCAGGAGAATAGGG + Intergenic
1176211871 20:63928155-63928177 AAGTGTGAGACGGCAGAATACGG - Intronic
1177383042 21:20370565-20370587 CTCTGTGTGGAAGGAGAATATGG + Intergenic
1178018191 21:28376789-28376811 CCCAGTGAGGCATGAGAATAGGG + Intergenic
1178893939 21:36543283-36543305 CACTGTGAAGGGGGACAGTAGGG + Intronic
1178975710 21:37219654-37219676 CATTCTGAGGCAGGAGAATAGGG + Intergenic
1179354306 21:40644369-40644391 AATGGTGAGGCAGGAGAATAGGG + Intronic
1179970008 21:44830753-44830775 CCCGGTGAGACAGGAGAATAGGG - Intergenic
1180134529 21:45853671-45853693 CCCAGTGAGGCAGGAGAAGAGGG - Intronic
1180717345 22:17880846-17880868 CACTGTGCAGCGAGAGAAAAGGG + Intronic
1181283297 22:21735334-21735356 CACGGCGGGGCGGGAGAAGAGGG + Intronic
1182399684 22:30066198-30066220 CAGGCTGAGGCGGGAGAATCAGG - Intergenic
1182576291 22:31275321-31275343 CCCTGTGAGCTGGGAGAAAAAGG - Intronic
1183041018 22:35178072-35178094 CACTGACAGGCAGGAGAACATGG + Intergenic
1185107745 22:48883889-48883911 CCCACTGAGGCAGGAGAATAGGG + Intergenic
949929081 3:9064287-9064309 CACTGGGATGCAGGGGAATAAGG + Intronic
951570830 3:24061381-24061403 CACTTTGAAGCAGGAGGATATGG + Intergenic
954282088 3:49588289-49588311 CATAGTGAGGCAGGAGAATAGGG - Intronic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
955173187 3:56584987-56585009 CAGGCTGAGGCGGGAGAATCAGG + Intronic
955399955 3:58584605-58584627 CCTTCTGAGGCAGGAGAATAGGG + Intronic
955710952 3:61778597-61778619 CAAGTTGAGGCAGGAGAATAGGG - Intronic
956019930 3:64923449-64923471 CACAGTGTGGAGGGGGAATATGG - Intergenic
956121669 3:65972105-65972127 CAATGTGAGGTGGCAGAATTAGG - Intronic
956481872 3:69681247-69681269 CACTGTGTGGCAGGAGAAGAAGG + Intergenic
958627994 3:96650864-96650886 GACTTTGAGGCAGGAGAATAGGG - Intergenic
959596731 3:108136929-108136951 ACTTGTGAGGCAGGAGAATAGGG - Intergenic
961152376 3:124650060-124650082 CACAGTGAGGCTGGAGAGTAAGG - Intronic
962227133 3:133622588-133622610 CACTGGGGGGCTGGAGAATAAGG + Intronic
963171902 3:142259833-142259855 CAGTATGAGGCAGAAGAATAGGG - Intergenic
963914062 3:150841418-150841440 CCCAGTGAGACAGGAGAATAGGG + Intergenic
965440420 3:168706239-168706261 CTCTGTCAAGCTGGAGAATAAGG - Intergenic
967268561 3:187713913-187713935 CTTTGTGAGGCAGGAGAATAGGG - Intronic
967354910 3:188558219-188558241 CACAGTGAGGTGGGAAAGTATGG - Intronic
967510578 3:190306530-190306552 CACTGTGAGGTGGGAAGATCAGG + Exonic
968042562 3:195600360-195600382 CAAGCTGAGGCGGGAGAATCAGG + Intergenic
968251742 3:197222989-197223011 CACAGTGAGGCCGGAGCCTAAGG - Intronic
968893253 4:3383809-3383831 CACTGAGAGGCCAAAGAATATGG - Intronic
968949290 4:3682273-3682295 CATTGTGAGGCAGGAGAGTGGGG + Intergenic
969688749 4:8691749-8691771 TAAAGTGAGGCAGGAGAATAGGG + Intergenic
971282204 4:25250114-25250136 CAGGCTGAGGCGGGAGAATCAGG + Intronic
972745654 4:41930102-41930124 CATATTGAGGCAGGAGAATAGGG + Intergenic
972926701 4:44017100-44017122 AAAAGTGAGGCAGGAGAATAGGG - Intergenic
972982618 4:44724300-44724322 CACAGTGAGGCAGTAGAATAGGG - Intronic
973117930 4:46484491-46484513 CATTTTGAGGCAGGAAAATAGGG - Intergenic
973908452 4:55553865-55553887 CCTTTTGAGGCAGGAGAATAAGG - Intergenic
974362391 4:60899109-60899131 AACTGTGAGGAGGAAGAAAAAGG - Intergenic
975814283 4:78201827-78201849 CAGTGTGAGTTGGGAGAAAAGGG + Intronic
976128616 4:81859803-81859825 AAGTGTGAGGCAGTAGAATATGG - Intronic
976620151 4:87119107-87119129 CCCAGTGAGGCAGGAGAATAGGG - Intronic
978033800 4:103970867-103970889 CAAAGCGAGGCAGGAGAATAGGG + Intergenic
978947382 4:114516002-114516024 CAGGCTGAGGCGGGAGAATCAGG - Intergenic
979157651 4:117417948-117417970 CACTGTGAAACTGTAGAATAGGG + Intergenic
979426889 4:120578824-120578846 CAGTAAGATGCGGGAGAATAGGG - Intergenic
980877667 4:138678234-138678256 CACAGTGAGGCTGGAGGATGAGG + Intergenic
981592806 4:146383270-146383292 GACAGTGAAGCAGGAGAATAGGG + Intronic
981989627 4:150902400-150902422 CCCAGTGAGGCAGGAGAATAGGG + Intronic
983400340 4:167255921-167255943 GACTGTGAGAGGGGAGAATGGGG + Intergenic
984510161 4:180669297-180669319 CCTAGTGAGGCAGGAGAATAAGG - Intergenic
985420376 4:189779415-189779437 CAGTGTGAGGCTGGAGAGTTTGG - Intergenic
986387406 5:7248089-7248111 AACTGTGATGGGGGAGAATGTGG + Intergenic
989511639 5:42294739-42294761 AACTGGGAGGAGGGAGAAAAAGG + Intergenic
990145280 5:52752724-52752746 AACTTTGAGGCTGGAAAATAGGG - Intergenic
990364385 5:55054944-55054966 CTCTGTGAGGCAGGAGAATAGGG - Intergenic
990631802 5:57678678-57678700 CATTTTGAGGTGGGAGGATAGGG + Intergenic
992612970 5:78523431-78523453 CACAGTGAGGGGGTAGAAGAAGG + Intronic
993647491 5:90478040-90478062 CACACTGAGGCAGGAAAATAGGG - Intronic
994881823 5:105507580-105507602 GTCTGTGAGGCGGGAAAAGAGGG + Intergenic
995297149 5:110535803-110535825 ATCTGTGAGGCAGGAGAATAGGG + Intronic
995809259 5:116086246-116086268 CAAAGTGAGGCAGGAAAATAGGG - Intronic
998629009 5:143878029-143878051 TCTTGTGAGGCGGGAAAATAGGG + Intergenic
999455796 5:151714741-151714763 CAGGCTGAGGCGGGAGAATCAGG + Intergenic
999526684 5:152414096-152414118 CACTGTGAGGCAGGAGAATAGGG + Intronic
999532801 5:152480705-152480727 CAGGCTGAGGCGGGAGAATCAGG + Intergenic
999926286 5:156382164-156382186 CACTGTGTGGCCTGAGAGTATGG - Intronic
1000959640 5:167584658-167584680 AGGTGTGAGGCGGGAGAATACGG - Intronic
1001087789 5:168714019-168714041 AACTGTGAGGTGGGAGGAGAAGG - Intronic
1001405715 5:171475600-171475622 GACTGGGAGGTTGGAGAATAAGG - Intergenic
1002615892 5:180455826-180455848 CTCACTGAGGCAGGAGAATAGGG + Intergenic
1003312575 6:4982559-4982581 GATTGGGAGGCGTGAGAATAGGG - Intergenic
1003348121 6:5289913-5289935 CAAACTGAGGCAGGAGAATAGGG - Intronic
1003407587 6:5836543-5836565 CAGGCTGAGGCAGGAGAATAAGG + Intergenic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1007532556 6:42555725-42555747 GCCTCTGAGGCAGGAGAATAGGG + Intergenic
1008054400 6:46931349-46931371 GACTTTGAGGCTGGAGAAGAAGG - Intronic
1008112360 6:47506686-47506708 CAGAGTGAGGCAGGAGAATCAGG + Intronic
1010766510 6:79781799-79781821 GAATGTGAGGTGGGAGAAGAAGG + Intergenic
1011908802 6:92409304-92409326 CCTTGTGAGGCTGGAGAATAGGG + Intergenic
1012597874 6:101061284-101061306 TACTGTGGGGATGGAGAATAAGG + Intergenic
1012711570 6:102613568-102613590 CAGTGTGAGGCAGGAGAAGTGGG + Intergenic
1012927492 6:105282203-105282225 CACAGTGATGAGGGAGATTAAGG + Intronic
1013356768 6:109352081-109352103 CAATGTGAGGTGAGAGAAGAAGG - Intergenic
1013808481 6:114018434-114018456 CATTTTGAGGCAGGAAAATAGGG - Intergenic
1014800199 6:125770300-125770322 CAGGCTGAGGCGGGAGAATCAGG - Intergenic
1015014752 6:128398448-128398470 GTTTGTGAGGCAGGAGAATAGGG - Intronic
1015547821 6:134379430-134379452 CACAGTGAGACAGGAGAATAGGG - Intergenic
1015842357 6:137488978-137489000 CACTGCGGGGCGGGAGAGGATGG - Intergenic
1016668857 6:146676868-146676890 AACTGTGAGGCCGGAGACTCTGG + Intronic
1018514907 6:164568942-164568964 CCAGGTGAGGCAGGAGAATAGGG - Intergenic
1018891238 6:167984594-167984616 AGCTGTGAGGCAGGAGGATAGGG - Intergenic
1019030801 6:169009156-169009178 GACTATGAGGCAGAAGAATAGGG - Intergenic
1020660157 7:10972812-10972834 GAGAGTGAGGCAGGAGAATAGGG + Intergenic
1021008893 7:15437635-15437657 GAGGGTGAGGCGGGAGAATGGGG - Intronic
1021298814 7:18944491-18944513 CACTGTGATGTAAGAGAATAGGG - Intronic
1021991727 7:26147596-26147618 CAGGCTGAGGCGGGAGAATCAGG - Intergenic
1023659977 7:42461266-42461288 CACTGTAAGGAGGGAGATGATGG - Intergenic
1024459014 7:49640544-49640566 AACTGTGGGGTGGGAGAAGAGGG - Intergenic
1024828997 7:53426056-53426078 GCCTGTGAGGCAGGAGAATAGGG + Intergenic
1025052162 7:55740980-55741002 CACTGGGAGGCAGGAGAAGCTGG + Intergenic
1026508750 7:71009800-71009822 CCTTCTGAGGCGGGAGAATAGGG - Intergenic
1026620904 7:71949181-71949203 GGCTATGAGGCAGGAGAATAGGG + Intronic
1027005146 7:74686330-74686352 CATCATGAGGCCGGAGAATAGGG - Intronic
1027749472 7:82124177-82124199 ACCTATGAGGCAGGAGAATAGGG + Intronic
1030143812 7:106332400-106332422 CATTTTGAGGCAGGAGAATAGGG + Intergenic
1030609965 7:111678696-111678718 GACTGTGAGGCTGGAGTACAGGG - Intergenic
1030714486 7:112791689-112791711 AGCTGTGAGGCAGGACAATAGGG + Intergenic
1031620013 7:123924462-123924484 CATAATGAGGCAGGAGAATAGGG - Intergenic
1032252716 7:130271785-130271807 CCCTGTGAGGCAGAAGAATAGGG - Intronic
1033608298 7:142943238-142943260 CACTGGGAGGTGGGATAATAGGG - Intronic
1034268364 7:149791796-149791818 CACTGTGAGGCAGGGGGACAGGG - Intergenic
1034653541 7:152711527-152711549 GATTTTGAGGCAGGAGAATATGG + Intergenic
1034841101 7:154398017-154398039 CACTGTGATGCCGTAAAATATGG + Intronic
1036772663 8:11589760-11589782 CACCATGAGGAGGGAGAAGAAGG + Intergenic
1037532482 8:19791184-19791206 GATGGTGAGGCAGGAGAATAGGG + Intergenic
1038790072 8:30660610-30660632 CATTCTGAGGCAGGAGAATAGGG + Intergenic
1038840106 8:31176938-31176960 AAAAGTGAGGCAGGAGAATAGGG + Intergenic
1038843735 8:31209988-31210010 CCATGTGAGGCAGGACAATAGGG + Intergenic
1039459892 8:37735431-37735453 CAATGTGATGCTGGTGAATAGGG + Exonic
1040683070 8:49837432-49837454 GATTATGAGGCAGGAGAATAGGG + Intergenic
1042224377 8:66504129-66504151 CACAGTGGGGAGGGAGAATGGGG - Intronic
1042844188 8:73154027-73154049 CCTAGTGAGGCAGGAGAATAGGG - Intergenic
1042999237 8:74736902-74736924 TACACTGAGGCAGGAGAATAGGG + Intronic
1043592065 8:81843889-81843911 CAATGTTAGGTAGGAGAATAGGG + Intergenic
1043961750 8:86424700-86424722 CAGGCTGAGGCGGGAGAATCAGG + Intronic
1044108938 8:88247867-88247889 CACTGTGATGAGAGAGAGTAGGG - Intronic
1044309693 8:90679477-90679499 CATAGTGAGGCAGGAAAATAGGG + Intronic
1046304051 8:112338975-112338997 TACAGTGAGGTGGGAGAATTGGG + Intronic
1048225792 8:132584177-132584199 CGCAGTGAGCCGGGAGAATGAGG - Intronic
1052979886 9:34440444-34440466 CTCTGTGAGGAGAGACAATAGGG + Intronic
1053004600 9:34596128-34596150 CACTGTGAGGGAGGACAAAAGGG - Intergenic
1053564744 9:39237186-39237208 CCCTGTGAGGAGGGAGGATTGGG - Intronic
1054132407 9:61381848-61381870 CCCTGTGAGGAGGGAGGATTGGG + Intergenic
1055690218 9:78822001-78822023 CATGGTGAAGCAGGAGAATAGGG - Intergenic
1056166655 9:83947614-83947636 CAGTCTGAGGCAGGAGAATCAGG - Intronic
1057751340 9:97795945-97795967 CAGTCTGAGGCAGGAGAATCAGG - Intergenic
1058455775 9:105136844-105136866 CCCAGCGAGGCAGGAGAATAGGG - Intergenic
1058767168 9:108192769-108192791 CTCTGTGTGGTGGGAGCATAAGG - Intergenic
1058971636 9:110088615-110088637 TATTTTGAGGCAGGAGAATAGGG - Intronic
1186818198 X:13258761-13258783 CCCACTGAGGCAGGAGAATAGGG + Intergenic
1187412991 X:19067013-19067035 CACTTTGAGGCAGGAAAATAGGG + Intronic
1189416389 X:40817794-40817816 CAAGGTGAGGCAGGAGAATAGGG - Intergenic
1189677134 X:43473011-43473033 GAATGTGAGGCAGGAGAATAGGG - Intergenic
1189704927 X:43750307-43750329 CACTGTGTGGCAAGAGACTAAGG + Intergenic
1189815205 X:44817808-44817830 CATTCTGAGGCAGGAGAATAGGG - Intergenic
1190766469 X:53479764-53479786 CCCTACGAGGCAGGAGAATAGGG - Intergenic
1190957612 X:55210820-55210842 CATTTTGAGGCAGGAGAATAGGG + Intronic
1192611529 X:72571988-72572010 CACTGTGAAGCAGGATATTAAGG + Intronic
1193117371 X:77788444-77788466 TAATGTGAGGCAGGAGAATAGGG - Intergenic
1193135108 X:77962195-77962217 CCCAGTGAGGCTGGAAAATAGGG + Intronic
1193689247 X:84620477-84620499 AACTGTGTGGGGGGAGTATATGG - Intergenic
1195206151 X:102601791-102601813 CACAGGGAGACAGGAGAATATGG - Exonic
1195899321 X:109781039-109781061 CATAGTGAGGCAGGAAAATAGGG + Intergenic
1196781661 X:119389106-119389128 CCCAGTGAGGCAGGAGAATAGGG + Intergenic
1196858120 X:120002203-120002225 CATAGTGAGGCAGGAGAATAGGG - Intergenic
1196872839 X:120128957-120128979 CCCTGTGAAGCAGGAGAATAGGG - Intergenic
1196999807 X:121426615-121426637 CACTGTGAGAAGTGAGAATATGG - Intergenic
1197243665 X:124146414-124146436 CCCAGTGAGGCAGGAAAATAGGG - Intronic
1199806315 X:151304424-151304446 TACTGTGAAGAGGGAGAAAAAGG - Intergenic
1201592984 Y:15636104-15636126 CAGTGTGAGGCGAGAGAGTGGGG - Intergenic
1202129671 Y:21598274-21598296 CAGTCTGAGGTGTGAGAATACGG - Intergenic