ID: 1144426679

View in Genome Browser
Species Human (GRCh38)
Location 17:15149489-15149511
Sequence ATGCCCTTTTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144426679_1144426681 2 Left 1144426679 17:15149489-15149511 CCTTCACTCTTCTAAAAGGGCAT No data
Right 1144426681 17:15149514-15149536 TTTGTTAGGTCCTATTTCCATGG No data
1144426679_1144426682 7 Left 1144426679 17:15149489-15149511 CCTTCACTCTTCTAAAAGGGCAT No data
Right 1144426682 17:15149519-15149541 TAGGTCCTATTTCCATGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144426679 Original CRISPR ATGCCCTTTTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr