ID: 1144429428

View in Genome Browser
Species Human (GRCh38)
Location 17:15177501-15177523
Sequence CTTGATCCCCAAGAAAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144429428_1144429432 -3 Left 1144429428 17:15177501-15177523 CCACCCCTTTCTTGGGGATCAAG No data
Right 1144429432 17:15177521-15177543 AAGCCTTCACAATATTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144429428 Original CRISPR CTTGATCCCCAAGAAAGGGG TGG (reversed) Intergenic
No off target data available for this crispr