ID: 1144434202

View in Genome Browser
Species Human (GRCh38)
Location 17:15224397-15224419
Sequence GAGGGCAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2999
Summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144434202_1144434212 24 Left 1144434202 17:15224397-15224419 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144434202 Original CRISPR GAGGGCAAGCAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr