ID: 1144434212

View in Genome Browser
Species Human (GRCh38)
Location 17:15224444-15224466
Sequence TAGTCCCAATGAGATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144434203_1144434212 21 Left 1144434203 17:15224400-15224422 CCCTGCTTCTGCTTGCCCTCCGT No data
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data
1144434201_1144434212 25 Left 1144434201 17:15224396-15224418 CCCACCCTGCTTCTGCTTGCCCT 0: 75
1: 252
2: 589
3: 812
4: 1291
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data
1144434204_1144434212 20 Left 1144434204 17:15224401-15224423 CCTGCTTCTGCTTGCCCTCCGTG 0: 14
1: 154
2: 428
3: 729
4: 1318
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data
1144434207_1144434212 6 Left 1144434207 17:15224415-15224437 CCCTCCGTGGGCTGCACCCACTG 0: 270
1: 1107
2: 892
3: 506
4: 365
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data
1144434208_1144434212 5 Left 1144434208 17:15224416-15224438 CCTCCGTGGGCTGCACCCACTGT 0: 248
1: 1056
2: 914
3: 500
4: 346
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data
1144434210_1144434212 -10 Left 1144434210 17:15224431-15224453 CCCACTGTCTAACTAGTCCCAAT 0: 10
1: 362
2: 958
3: 1070
4: 1084
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data
1144434209_1144434212 2 Left 1144434209 17:15224419-15224441 CCGTGGGCTGCACCCACTGTCTA 0: 309
1: 902
2: 774
3: 388
4: 331
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data
1144434200_1144434212 26 Left 1144434200 17:15224395-15224417 CCCCACCCTGCTTCTGCTTGCCC 0: 63
1: 240
2: 550
3: 1053
4: 2832
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data
1144434202_1144434212 24 Left 1144434202 17:15224397-15224419 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1144434212 17:15224444-15224466 TAGTCCCAATGAGATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144434212 Original CRISPR TAGTCCCAATGAGATGAGAC AGG Intergenic
No off target data available for this crispr