ID: 1144435263

View in Genome Browser
Species Human (GRCh38)
Location 17:15234220-15234242
Sequence GTGTGTTCACTCAGGCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144435258_1144435263 -7 Left 1144435258 17:15234204-15234226 CCAGCATGACCGCCTGGTGTGTT 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1144435263 17:15234220-15234242 GTGTGTTCACTCAGGCAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144435263 Original CRISPR GTGTGTTCACTCAGGCAAGT GGG Intronic
902755407 1:18546123-18546145 GTGTGGTCTCTATGGCAAGTGGG - Intergenic
905347120 1:37318735-37318757 GTGGGTTCACACAGGCGTGTGGG + Intergenic
906765524 1:48427955-48427977 GTGTGTTCTCTCTTACAAGTAGG - Intronic
907352511 1:53844428-53844450 CTGTGGTCACTCAGGCATCTGGG - Intergenic
908783575 1:67713607-67713629 GTGTGTTTGCTCATGAAAGTTGG - Intronic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
911181721 1:94866702-94866724 ATGTGTTCACTCTGGAGAGTGGG + Intronic
918971583 1:191426848-191426870 ATGTGTTCACACTGGCCAGTTGG + Intergenic
923500896 1:234562703-234562725 CTGTGTTCCCTCAGGCATCTTGG + Intergenic
1065997418 10:31071779-31071801 GTGAGTACACTCAGTCCAGTCGG + Intergenic
1066526313 10:36283482-36283504 GTGTCTTCAGTTAGGCAAATGGG - Intergenic
1072139972 10:92580922-92580944 GTGGGAACACTCAGGAAAGTGGG - Intergenic
1076035735 10:127196903-127196925 GTGTGTTCTCTCAGGGATGGGGG + Intronic
1076226060 10:128776466-128776488 GTGTAATCACTCAGGTAATTTGG + Intergenic
1078092822 11:8277917-8277939 GTGTGTTCACTCTGGTGAGCCGG - Intergenic
1079793743 11:24772303-24772325 GTGTGTTTATTGAGGCAAGAAGG - Intronic
1081346466 11:41993250-41993272 GTGGGTAAACTGAGGCAAGTTGG - Intergenic
1084054964 11:66626093-66626115 GTGCGTCCACTCTGGGAAGTTGG + Intronic
1084233387 11:67769700-67769722 GGCTGTACACTCAGGCAAGAGGG + Intergenic
1086805006 11:91230166-91230188 GTGTGTTCACTTAGGCTAGAGGG + Intergenic
1086983072 11:93219618-93219640 GTGTGTTCATACATGCAAGAGGG + Intergenic
1087359245 11:97136905-97136927 GTCTTTTCATTCAGGGAAGTGGG + Intergenic
1089632023 11:119789788-119789810 GTGTGTGCACACAGGCACTTTGG + Intergenic
1093387281 12:18573476-18573498 GGGTGTTTACTCACACAAGTGGG - Intronic
1098065703 12:66614041-66614063 GTGTGGTCAGTGAGGCAGGTGGG - Intronic
1104882915 12:132084616-132084638 GAGTGTTCACTGAGGGAGGTGGG - Intronic
1106024113 13:25940853-25940875 GTGAGGTCACTCAGGCACGATGG - Intronic
1107043504 13:35973001-35973023 GGGTGCTGACTCAGGCAAGTGGG - Intronic
1110635065 13:77757658-77757680 GTATGTTCTCTCATGTAAGTGGG - Intronic
1110794130 13:79617893-79617915 GTGTGTGCACTCAGTAAAGTGGG + Intergenic
1112207396 13:97338192-97338214 GTGTGTTCACCCAGCAATGTAGG - Intronic
1112252816 13:97799104-97799126 TTGTGTTGACTCAGCCCAGTTGG - Intergenic
1113960916 13:114125758-114125780 CTGTGTTCACGCAGGAAAGGAGG - Intronic
1115860715 14:37683079-37683101 GTGTGTTCACTCTGAAAAGGGGG + Intronic
1120850810 14:89167784-89167806 GTGTGAGCAATCAGGCAACTAGG + Intronic
1121132791 14:91463986-91464008 GTGTGTTCTCTCTTGTAAGTGGG - Intronic
1121191087 14:92030759-92030781 GTGTGTACACAAAGGCAACTGGG + Intronic
1122544367 14:102514064-102514086 GTATGTGCACTCAGACACGTGGG + Intergenic
1125383816 15:39115276-39115298 GTATGGTGACTCAGGCAAGCTGG - Intergenic
1131102637 15:89705243-89705265 GTGTGCTCAATCAGGCAGATAGG + Intronic
1134008799 16:10835892-10835914 GTGTGTGCAGTGAGGAAAGTGGG - Intergenic
1137592606 16:49702888-49702910 GCGTGTGCACACAGGCAGGTTGG - Intronic
1140298179 16:73728995-73729017 GTGTGTTCAGCCAGGGAAGAAGG + Intergenic
1142980046 17:3666456-3666478 GTGTGTTCAGCCAGGCACGGTGG - Intronic
1143007559 17:3846540-3846562 TAGTGATCACTCAGGAAAGTTGG - Intergenic
1143519201 17:7436095-7436117 GTGAGTTCCCAAAGGCAAGTAGG - Intronic
1144435263 17:15234220-15234242 GTGTGTTCACTCAGGCAAGTGGG + Intronic
1145398347 17:22512836-22512858 CTGTGGTCAGGCAGGCAAGTGGG + Intergenic
1146852234 17:36232450-36232472 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1146868142 17:36356321-36356343 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1146978711 17:37139441-37139463 GACTGTTCACTGAGGCAAGAGGG + Intronic
1147071016 17:37956939-37956961 TTAGGTTCACTCAGGGAAGTGGG - Intergenic
1147082542 17:38036465-38036487 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1147098486 17:38160433-38160455 TTAGGTTCACTCAGGGAAGTGGG - Intergenic
1148000645 17:44385277-44385299 CCGTGGTCACTCAGGCGAGTAGG - Exonic
1148544368 17:48505978-48506000 ATGTGGTCACTAAGGCAACTGGG + Intergenic
1159022063 18:63151453-63151475 GCGAGTTCACTCAGGCAAGGGGG + Intronic
1159049054 18:63400156-63400178 GCTTGTTCTCTCTGGCAAGTTGG + Exonic
1159304826 18:66627145-66627167 GTGTGTTCTCACATGTAAGTGGG + Intergenic
1168265777 19:55223359-55223381 GTCTCATCACTCTGGCAAGTTGG + Intergenic
926330361 2:11820414-11820436 GTGTATTCATACAAGCAAGTAGG + Exonic
926665262 2:15515055-15515077 ATGTGTTCACACATCCAAGTAGG + Intronic
929237007 2:39616121-39616143 GTGTGTTCATTCATAGAAGTAGG + Intergenic
929765870 2:44843735-44843757 GTGGGGTCACCCAGGCACGTTGG + Intergenic
931175979 2:59855832-59855854 GTTTGTGCCCTCAGGAAAGTGGG - Intergenic
931195877 2:60052059-60052081 CTGTCTTCACTCAGGCAATGGGG - Intergenic
937282902 2:120732605-120732627 GTCTCTTTACTCAGGCTAGTTGG - Intergenic
938855766 2:135308751-135308773 GAATGTTCACTCAGGCATGGTGG - Intronic
938998302 2:136703998-136704020 GTGTGATCCCTCAGGAAAGTAGG - Intergenic
941127265 2:161599285-161599307 GTGTGTTCACACTTACAAGTGGG + Intronic
941620371 2:167771287-167771309 GTGTGTTTAAACAGTCAAGTAGG + Intergenic
943480406 2:188410773-188410795 GGGAGTTCACTCAGGCTGGTGGG + Intronic
943481325 2:188421881-188421903 GTGTTTTCACTCCTGGAAGTTGG - Intronic
944064129 2:195601547-195601569 GTGTGAGGACTCAGGCAAGGGGG + Intronic
1168753373 20:298806-298828 GTGTGTTCACCCTGGCAGGCAGG - Exonic
1168901359 20:1367794-1367816 GTGCCTTCACTCAGGCATATGGG - Intronic
1172307004 20:33887974-33887996 ATGTATTAACTCAAGCAAGTAGG - Intergenic
1175808317 20:61843897-61843919 GGGGGTTCCCTCAGGGAAGTTGG - Intronic
1178000293 21:28154502-28154524 GAGTATTCATTCAGGTAAGTAGG - Intergenic
1180137743 21:45871989-45872011 GTTTGCTCACTCATGCATGTGGG - Intronic
1180874389 22:19168390-19168412 GTGTGTTTACCCAGGTGAGTAGG - Intergenic
1182308464 22:29388128-29388150 GAGTTTTCCCTCAGGCCAGTGGG + Intronic
1183848106 22:40559692-40559714 ATGTGTTCTGTCAGGCAAGGTGG - Intronic
955040298 3:55310400-55310422 GTATATTCACTCAGTCAAGTTGG - Intergenic
956479732 3:69661439-69661461 GTGTGTTCACTCCTGCCGGTGGG - Intergenic
957050670 3:75409586-75409608 GGCTGTACACTCAGGCAAGAGGG + Intergenic
961221295 3:125202379-125202401 GGGTGTTCAATCAGGCCAGGCGG + Intronic
961882975 3:130076018-130076040 GGCTGTACACTCAGGCAAGAGGG + Intergenic
961933312 3:130556109-130556131 GTGTGTTCTCACTTGCAAGTAGG - Intergenic
962181860 3:133214465-133214487 GAGGGTTCTCTCAGGCACGTTGG + Intronic
962400906 3:135058026-135058048 GTGGGTTCTCTGAGGCAAGATGG + Intronic
963645973 3:147915255-147915277 GTGTGCTCCCACAGGCGAGTGGG + Intergenic
963786004 3:149535042-149535064 GAGTGTTCCCTCAGCCAAGGCGG - Intronic
964577382 3:158188157-158188179 GTGTCTCCACTCTGGCTAGTGGG + Intronic
967405032 3:189105878-189105900 GTGTGTCCACTGGGGCATGTTGG + Intronic
970644226 4:18101120-18101142 GTGTATTCACAAAGGAAAGTAGG - Intergenic
971579615 4:28318372-28318394 GAGTGATCACTTAGGCAAGAAGG + Intergenic
973903252 4:55499852-55499874 GTGTGTTCATACATGCAATTAGG + Intronic
979986288 4:127319773-127319795 GGGAGTTCACTCAGGCTGGTAGG - Intergenic
982440264 4:155426915-155426937 GGGAGTTCAGTCAGGCTAGTGGG + Intergenic
988394435 5:30679260-30679282 GGGAGTTCAGTCAGGCAGGTGGG + Intergenic
989250067 5:39303221-39303243 GTGTTAACATTCAGGCAAGTTGG + Intronic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
991028030 5:62052039-62052061 GTGTGTTCACACTGGCAATGGGG + Intergenic
992870127 5:80997512-80997534 GTGTATTTATCCAGGCAAGTTGG + Intronic
994157779 5:96522910-96522932 GTGTGGTCACTGGGGCGAGTGGG + Intergenic
994157850 5:96523466-96523488 GTGTGGTCACTGGGGCAAGTGGG - Intergenic
994320195 5:98386382-98386404 GTCTCTTCTTTCAGGCAAGTGGG + Intergenic
997640592 5:135446368-135446390 ACATGTTCACTCAGGCACGTGGG + Exonic
1002391926 5:178920740-178920762 GTGTGTTCACTCTGACTTGTTGG + Intronic
1003840207 6:10112156-10112178 GTAGGTTGACTCAGGCAAGAAGG - Intronic
1007124471 6:39413774-39413796 ATGTGTTGTCTCAGGTAAGTGGG - Intronic
1008666240 6:53719483-53719505 GTGGCTTCACTTAGGCAAATAGG + Intergenic
1010528351 6:76932727-76932749 GTGTTTTAATTCAGGCAATTTGG + Intergenic
1011745966 6:90408010-90408032 GGGAGTTCAGTCAGGCTAGTGGG - Intergenic
1011857485 6:91712947-91712969 GTGTGTTCACTTTGGCACTTTGG + Intergenic
1013000894 6:106021121-106021143 GTGTGTGCACTAAATCAAGTTGG + Intergenic
1014663612 6:124206366-124206388 CTGTGTTCCCTTAAGCAAGTAGG - Intronic
1017559223 6:155608751-155608773 GTGTGTGCACACATGCACGTAGG - Intergenic
1020316991 7:6912758-6912780 GGCTGTACACTCAGGCAAGAGGG + Intergenic
1025246760 7:57323380-57323402 GTGTGATGACTCAGGCATGAAGG - Intergenic
1025935519 7:66032677-66032699 GTTTCTTCACTCAGGAAAGATGG - Intergenic
1025948815 7:66127198-66127220 GTTTCTTCACTCAGGAAAGATGG + Intronic
1029641764 7:101825358-101825380 GTCTCGTCACTCAGCCAAGTGGG + Intronic
1029798366 7:102920027-102920049 GTGTGTTCATACAGGGGAGTAGG + Intronic
1033807099 7:144966894-144966916 GTGTGTTCTCTCTTGTAAGTGGG + Intergenic
1045276818 8:100714040-100714062 GGGTGGTATCTCAGGCAAGTGGG + Intronic
1047380009 8:124352794-124352816 GTGTATCCACACAGGCAGGTTGG + Intronic
1050750272 9:8929152-8929174 GTGTGTTCAGTTAGGAAAGGAGG - Intronic
1051119120 9:13732298-13732320 GTCTGTTCTATCTGGCAAGTTGG - Intergenic
1053139619 9:35674434-35674456 CTCTGTTCACTCAGGGAAGGAGG + Intronic
1053284522 9:36841684-36841706 GTTTGCTCACTCAGCAAAGTTGG - Intronic
1053860295 9:42379921-42379943 GGGGGTTCAATCAGGCCAGTTGG + Intergenic
1054777573 9:69136788-69136810 GTGTGTTCACTCAGGCTTCCTGG + Intronic
1056000017 9:82205275-82205297 GTGTGTTCACTCATTAAAATAGG + Intergenic
1056703522 9:88931963-88931985 GTGTGCTCCCTCAGAAAAGTTGG - Intergenic
1057180850 9:93029365-93029387 GTCTGCACACTCAGGCATGTGGG + Intronic
1058871257 9:109203401-109203423 GGGTTGTCACTCAAGCAAGTGGG - Intronic
1186620271 X:11233304-11233326 GTGTGAGTACTGAGGCAAGTAGG - Intronic
1187944073 X:24409519-24409541 GTGTGTTCAGTCAGTTAAGATGG + Intergenic
1190749842 X:53352504-53352526 GTGTGTTTTCTCAGTCACGTTGG - Intergenic
1193630420 X:83879510-83879532 GTGTGTTTTCACAAGCAAGTTGG - Intronic
1195867503 X:109448974-109448996 GTGTATTCACGCAGTCAGGTAGG + Intronic
1197142921 X:123136639-123136661 GTATGTTCTCACAGGTAAGTGGG + Intergenic
1201978013 Y:19873163-19873185 GAGGGTTCAGTCAGGCATGTGGG + Intergenic