ID: 1144440378

View in Genome Browser
Species Human (GRCh38)
Location 17:15275997-15276019
Sequence GAGAACTCCAGCCAGCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144440378_1144440383 24 Left 1144440378 17:15275997-15276019 CCCCAGTGCTGGCTGGAGTTCTC No data
Right 1144440383 17:15276044-15276066 GCTGAGCCCTTTCACCAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144440378 Original CRISPR GAGAACTCCAGCCAGCACTG GGG (reversed) Intergenic
No off target data available for this crispr