ID: 1144441657

View in Genome Browser
Species Human (GRCh38)
Location 17:15287967-15287989
Sequence CATTGGTTCTACAGGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144441654_1144441657 27 Left 1144441654 17:15287917-15287939 CCTCTCTCGGGCAGCAGAAGGGA No data
Right 1144441657 17:15287967-15287989 CATTGGTTCTACAGGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144441657 Original CRISPR CATTGGTTCTACAGGCAAAC AGG Intergenic
No off target data available for this crispr