ID: 1144445089

View in Genome Browser
Species Human (GRCh38)
Location 17:15319719-15319741
Sequence ACGTGTGTGGTCCAGTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144445089_1144445091 -3 Left 1144445089 17:15319719-15319741 CCTCTCTACTGGACCACACACGT 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1144445091 17:15319739-15319761 CGTTGCCTTTTGATGCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144445089 Original CRISPR ACGTGTGTGGTCCAGTAGAG AGG (reversed) Intronic
901678602 1:10900720-10900742 AGGTGTGTGTTCCAGAGGAGGGG + Intergenic
903646029 1:24897030-24897052 ACCTGTGTGGTCCAGTGGCTGGG - Intergenic
904755437 1:32766174-32766196 ACGTGGGCGGCCCAGAAGAGAGG + Intronic
905860877 1:41350224-41350246 AAGTGTGTGGTCCAGCAGCCTGG - Intergenic
911909258 1:103611644-103611666 ATGTTTGTAGTCCAGTAGATAGG + Intergenic
913023918 1:114816166-114816188 ACGTGTCTGGCACAGTAGTGTGG + Intergenic
913454070 1:119013120-119013142 ATGGGAGTGATCCAGTAGAGAGG - Intergenic
916510393 1:165467913-165467935 ACCTTTGGGGTCCAGTAGGGTGG + Intergenic
919824302 1:201492818-201492840 ACATGTGTGGCCCACTGGAGGGG - Intronic
923565324 1:235072185-235072207 AGGGGTGTGGTCCTGTAGGGAGG - Intergenic
924507434 1:244699076-244699098 AGGTGTGTGCACCAGTAGAAAGG - Intronic
1062992048 10:1828524-1828546 AGGTGTGTGCTCCCGTGGAGTGG - Intergenic
1069292852 10:66804464-66804486 ACATGTGGGGTGCAGGAGAGAGG - Intronic
1070665235 10:78337965-78337987 CCATGTGTGGCCCAGGAGAGTGG - Intergenic
1071968492 10:90877597-90877619 ACCTGTGTGGTCAAGCAGACAGG + Intronic
1072449393 10:95527641-95527663 TCCTGTGTGATCCAGTAGAGAGG + Intronic
1083614279 11:64018671-64018693 AGGGGGGTGGTGCAGTAGAGAGG - Intronic
1083899569 11:65637036-65637058 AGTTCTGTGGTCCAGCAGAGAGG - Exonic
1090802490 11:130181562-130181584 TCGGCTGTGGCCCAGTAGAGAGG + Intronic
1092232858 12:6786618-6786640 AGGTGGGTGGTGCAGAAGAGAGG - Intergenic
1102154863 12:110716965-110716987 ACGTGTGAGCTTCAGAAGAGTGG - Intergenic
1104802959 12:131567169-131567191 AGGTGGGTGGCTCAGTAGAGGGG - Intergenic
1107871272 13:44748877-44748899 ACCTCTGTGGGCCAGTGGAGAGG - Intergenic
1110801663 13:79703996-79704018 ACATGTGTGGTCCAGCATGGTGG - Intergenic
1119077976 14:71663574-71663596 ACTTGTGTGGTTCATTACAGTGG - Intronic
1123143993 14:106110285-106110307 GCGTGTGTGCTCCAGTAAAGAGG - Intergenic
1124829338 15:33132915-33132937 TCATGTTTTGTCCAGTAGAGGGG - Intronic
1127166067 15:56245239-56245261 AAGTCTGTGGGCCAGGAGAGAGG - Intronic
1128026203 15:64439146-64439168 ACGTTTATCTTCCAGTAGAGTGG + Intronic
1134409822 16:13994614-13994636 CCCTGTGTTGTCCAGGAGAGGGG - Intergenic
1142221659 16:88857789-88857811 ATGTATGTGGGCCAGTAAAGAGG - Intronic
1142300788 16:89256826-89256848 ACCTGTGTGGTCCCGGGGAGGGG - Intergenic
1144445089 17:15319719-15319741 ACGTGTGTGGTCCAGTAGAGAGG - Intronic
1145750372 17:27351017-27351039 ACCTGTGTGGGCAAGTACAGAGG + Intergenic
1151914974 17:77111213-77111235 ATGTGTGTGGTCCAGAAAGGCGG + Intronic
1152829628 17:82489252-82489274 CCGAGTGTGGTCCAGGAGGGTGG - Exonic
1153410691 18:4789375-4789397 ACGTGTGTGGTCCACTATCATGG - Intergenic
1154066911 18:11115836-11115858 AAGTTTGTGTCCCAGTAGAGAGG + Intronic
1164182656 19:22832847-22832869 TAGTTTGTGGTCCATTAGAGGGG + Intergenic
1166680099 19:44760810-44760832 ACAGATGTGGTCCATTAGAGGGG - Intergenic
1168342400 19:55632733-55632755 ATGTGTGTGGTCCAGTGGAAAGG + Intergenic
926423840 2:12723642-12723664 CCGTCTGTGGTCCAGATGAGGGG + Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
928407131 2:31023408-31023430 ATGGGAGTGGTCCAGCAGAGAGG - Intronic
929282745 2:40100190-40100212 ATGTGTGTGGTCCATTAAAAAGG - Intronic
930307403 2:49692743-49692765 AAGTATGTAGTCAAGTAGAGTGG - Intergenic
939073349 2:137569490-137569512 ACCTGTGTGGACCAGGGGAGAGG + Intronic
941438171 2:165497799-165497821 AGCTGTGTGGTCTGGTAGAGAGG - Intronic
1169867217 20:10215132-10215154 ACGCCTGTGGTCCAGTAGGGAGG - Intergenic
1176411353 21:6451065-6451087 ACCAGTGAGGTCCAGGAGAGGGG - Intergenic
1179686846 21:43059387-43059409 ACCAGTGAGGTCCAGGAGAGGGG - Intronic
1182426482 22:30275925-30275947 AGGTGTGGGGTCCTGCAGAGTGG + Intergenic
1184351563 22:43947455-43947477 AGTTGTGTGCTCCAGTGGAGAGG - Exonic
951206512 3:19931453-19931475 ACCGGTGTGGTCAAGTAAAGTGG + Intronic
953703476 3:45214102-45214124 ACGTGTGTGGGCCAGGAGGTGGG + Intergenic
955860478 3:63324573-63324595 AGATGTGTGGTCCAGGTGAGTGG + Intronic
964785582 3:160392372-160392394 AAGTGTGGGGTTCAGTGGAGAGG - Intronic
974585342 4:63867539-63867561 ACGTGAATGATCCAATAGAGAGG - Intergenic
977448959 4:97169962-97169984 ACATGGATGATCCAGTAGAGAGG - Intergenic
980606389 4:135096198-135096220 GCATGTGTGTTCCAGGAGAGGGG + Intergenic
995853352 5:116569912-116569934 ATTTGTGAGGTCCAGGAGAGAGG + Intronic
998631946 5:143908853-143908875 ATGTGTGTAGTCCAGGAGAGTGG + Intergenic
1000253584 5:159517579-159517601 GCTGGTGTGGTCCAGTGGAGAGG + Intergenic
1000307098 5:160004732-160004754 ATATGTGTGGCCCAGTACAGTGG + Intergenic
1003674381 6:8189550-8189572 ATGTGTGGGGTACAGAAGAGTGG + Intergenic
1026564874 7:71481538-71481560 TTGTGTGTTTTCCAGTAGAGTGG + Intronic
1031820488 7:126495203-126495225 ACGTGTGTGCTCCAAAACAGAGG + Intronic
1034351792 7:150420652-150420674 ACGTGAGTTGTCCAGGACAGTGG + Intergenic
1034649037 7:152675318-152675340 AAGTTTGTTGTCCATTAGAGGGG - Intronic
1037574745 8:20191178-20191200 AGATGTGTTGTCCAATAGAGGGG - Intergenic
1048261888 8:132952227-132952249 ATGTGTGTGGAGCAGCAGAGTGG + Intronic
1049987613 9:966611-966633 AAGAATGTGGTCCAGTGGAGTGG + Intronic
1050209188 9:3234166-3234188 AAGTGTATGGTCTAGAAGAGGGG + Intronic
1060118299 9:120963952-120963974 ACTTCTGTGTTCCAGTAGAGTGG - Intronic
1187085439 X:16038015-16038037 TCTTGTGTGGTGCAGTAGATGGG - Intergenic
1188237493 X:27747829-27747851 AAGTGTGTGGCCCAGCACAGGGG + Exonic
1194204873 X:91001246-91001268 ATGTGTTTGGTCCAGAAAAGTGG - Intergenic
1195064960 X:101232323-101232345 ATGTGTGTGAGACAGTAGAGAGG + Intronic
1196147629 X:112336703-112336725 ATATGTGCTGTCCAGTAGAGTGG - Intergenic
1200550700 Y:4576391-4576413 ATGTGTTTGGTCCAGAAAAGTGG - Intergenic