ID: 1144448037

View in Genome Browser
Species Human (GRCh38)
Location 17:15349405-15349427
Sequence ATCTGCTTCTTTAGGTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144448037_1144448040 -8 Left 1144448037 17:15349405-15349427 CCTTATAACCTAAAGAAGCAGAT No data
Right 1144448040 17:15349420-15349442 AAGCAGATAGAAACACAGATGGG No data
1144448037_1144448043 7 Left 1144448037 17:15349405-15349427 CCTTATAACCTAAAGAAGCAGAT No data
Right 1144448043 17:15349435-15349457 CAGATGGGATACTTAGAGTGGGG No data
1144448037_1144448042 6 Left 1144448037 17:15349405-15349427 CCTTATAACCTAAAGAAGCAGAT No data
Right 1144448042 17:15349434-15349456 ACAGATGGGATACTTAGAGTGGG No data
1144448037_1144448041 5 Left 1144448037 17:15349405-15349427 CCTTATAACCTAAAGAAGCAGAT No data
Right 1144448041 17:15349433-15349455 CACAGATGGGATACTTAGAGTGG No data
1144448037_1144448039 -9 Left 1144448037 17:15349405-15349427 CCTTATAACCTAAAGAAGCAGAT No data
Right 1144448039 17:15349419-15349441 GAAGCAGATAGAAACACAGATGG No data
1144448037_1144448044 19 Left 1144448037 17:15349405-15349427 CCTTATAACCTAAAGAAGCAGAT No data
Right 1144448044 17:15349447-15349469 TTAGAGTGGGGAAAAATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144448037 Original CRISPR ATCTGCTTCTTTAGGTTATA AGG (reversed) Intergenic
No off target data available for this crispr