ID: 1144449538

View in Genome Browser
Species Human (GRCh38)
Location 17:15364654-15364676
Sequence TCCTTTCTCAACATTGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144449538_1144449546 21 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449546 17:15364698-15364720 TCCCTGAGCCTCGTGAGGTCAGG No data
1144449538_1144449550 25 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449550 17:15364702-15364724 TGAGCCTCGTGAGGTCAGGGAGG No data
1144449538_1144449545 16 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449545 17:15364693-15364715 AGGAGTCCCTGAGCCTCGTGAGG No data
1144449538_1144449548 22 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449548 17:15364699-15364721 CCCTGAGCCTCGTGAGGTCAGGG No data
1144449538_1144449544 -4 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449544 17:15364673-15364695 AGGAGCTGGAAGTATCAGGCAGG No data
1144449538_1144449543 -8 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449543 17:15364669-15364691 AGAAAGGAGCTGGAAGTATCAGG No data
1144449538_1144449552 27 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449552 17:15364704-15364726 AGCCTCGTGAGGTCAGGGAGGGG No data
1144449538_1144449551 26 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449551 17:15364703-15364725 GAGCCTCGTGAGGTCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144449538 Original CRISPR TCCTTTCTCAACATTGGGAT GGG (reversed) Intergenic