ID: 1144449539

View in Genome Browser
Species Human (GRCh38)
Location 17:15364655-15364677
Sequence CTCCTTTCTCAACATTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144449539_1144449552 26 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449552 17:15364704-15364726 AGCCTCGTGAGGTCAGGGAGGGG No data
1144449539_1144449551 25 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449551 17:15364703-15364725 GAGCCTCGTGAGGTCAGGGAGGG No data
1144449539_1144449546 20 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449546 17:15364698-15364720 TCCCTGAGCCTCGTGAGGTCAGG No data
1144449539_1144449544 -5 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449544 17:15364673-15364695 AGGAGCTGGAAGTATCAGGCAGG No data
1144449539_1144449543 -9 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449543 17:15364669-15364691 AGAAAGGAGCTGGAAGTATCAGG No data
1144449539_1144449550 24 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449550 17:15364702-15364724 TGAGCCTCGTGAGGTCAGGGAGG No data
1144449539_1144449548 21 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449548 17:15364699-15364721 CCCTGAGCCTCGTGAGGTCAGGG No data
1144449539_1144449545 15 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449545 17:15364693-15364715 AGGAGTCCCTGAGCCTCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144449539 Original CRISPR CTCCTTTCTCAACATTGGGA TGG (reversed) Intergenic