ID: 1144449542

View in Genome Browser
Species Human (GRCh38)
Location 17:15364660-15364682
Sequence TCCAGCTCCTTTCTCAACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144449542_1144449545 10 Left 1144449542 17:15364660-15364682 CCAATGTTGAGAAAGGAGCTGGA No data
Right 1144449545 17:15364693-15364715 AGGAGTCCCTGAGCCTCGTGAGG No data
1144449542_1144449550 19 Left 1144449542 17:15364660-15364682 CCAATGTTGAGAAAGGAGCTGGA No data
Right 1144449550 17:15364702-15364724 TGAGCCTCGTGAGGTCAGGGAGG No data
1144449542_1144449552 21 Left 1144449542 17:15364660-15364682 CCAATGTTGAGAAAGGAGCTGGA No data
Right 1144449552 17:15364704-15364726 AGCCTCGTGAGGTCAGGGAGGGG No data
1144449542_1144449544 -10 Left 1144449542 17:15364660-15364682 CCAATGTTGAGAAAGGAGCTGGA No data
Right 1144449544 17:15364673-15364695 AGGAGCTGGAAGTATCAGGCAGG No data
1144449542_1144449546 15 Left 1144449542 17:15364660-15364682 CCAATGTTGAGAAAGGAGCTGGA No data
Right 1144449546 17:15364698-15364720 TCCCTGAGCCTCGTGAGGTCAGG No data
1144449542_1144449551 20 Left 1144449542 17:15364660-15364682 CCAATGTTGAGAAAGGAGCTGGA No data
Right 1144449551 17:15364703-15364725 GAGCCTCGTGAGGTCAGGGAGGG No data
1144449542_1144449548 16 Left 1144449542 17:15364660-15364682 CCAATGTTGAGAAAGGAGCTGGA No data
Right 1144449548 17:15364699-15364721 CCCTGAGCCTCGTGAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144449542 Original CRISPR TCCAGCTCCTTTCTCAACAT TGG (reversed) Intergenic
No off target data available for this crispr