ID: 1144449543

View in Genome Browser
Species Human (GRCh38)
Location 17:15364669-15364691
Sequence AGAAAGGAGCTGGAAGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144449536_1144449543 7 Left 1144449536 17:15364639-15364661 CCGGCTGGCAGCAGACCCATCCC No data
Right 1144449543 17:15364669-15364691 AGAAAGGAGCTGGAAGTATCAGG No data
1144449538_1144449543 -8 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449543 17:15364669-15364691 AGAAAGGAGCTGGAAGTATCAGG No data
1144449539_1144449543 -9 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449543 17:15364669-15364691 AGAAAGGAGCTGGAAGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144449543 Original CRISPR AGAAAGGAGCTGGAAGTATC AGG Intergenic
No off target data available for this crispr