ID: 1144449548

View in Genome Browser
Species Human (GRCh38)
Location 17:15364699-15364721
Sequence CCCTGAGCCTCGTGAGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144449540_1144449548 17 Left 1144449540 17:15364659-15364681 CCCAATGTTGAGAAAGGAGCTGG No data
Right 1144449548 17:15364699-15364721 CCCTGAGCCTCGTGAGGTCAGGG No data
1144449538_1144449548 22 Left 1144449538 17:15364654-15364676 CCCATCCCAATGTTGAGAAAGGA No data
Right 1144449548 17:15364699-15364721 CCCTGAGCCTCGTGAGGTCAGGG No data
1144449542_1144449548 16 Left 1144449542 17:15364660-15364682 CCAATGTTGAGAAAGGAGCTGGA No data
Right 1144449548 17:15364699-15364721 CCCTGAGCCTCGTGAGGTCAGGG No data
1144449539_1144449548 21 Left 1144449539 17:15364655-15364677 CCATCCCAATGTTGAGAAAGGAG No data
Right 1144449548 17:15364699-15364721 CCCTGAGCCTCGTGAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144449548 Original CRISPR CCCTGAGCCTCGTGAGGTCA GGG Intergenic
No off target data available for this crispr