ID: 1144453881

View in Genome Browser
Species Human (GRCh38)
Location 17:15403422-15403444
Sequence GAGAATAGGGAGAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144453881_1144453889 10 Left 1144453881 17:15403422-15403444 CCAGCCACCCTCTCCCTATTCTC No data
Right 1144453889 17:15403455-15403477 TCAAAGCCTACCAGATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144453881 Original CRISPR GAGAATAGGGAGAGGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr