ID: 1144455916 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:15418176-15418198 |
Sequence | CACAGGCGAGGCCTCCTACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1144455911_1144455916 | -9 | Left | 1144455911 | 17:15418162-15418184 | CCATTAGGACATCCCACAGGCGA | No data | ||
Right | 1144455916 | 17:15418176-15418198 | CACAGGCGAGGCCTCCTACAGGG | No data | ||||
1144455910_1144455916 | -8 | Left | 1144455910 | 17:15418161-15418183 | CCCATTAGGACATCCCACAGGCG | No data | ||
Right | 1144455916 | 17:15418176-15418198 | CACAGGCGAGGCCTCCTACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1144455916 | Original CRISPR | CACAGGCGAGGCCTCCTACA GGG | Intergenic | ||