ID: 1144455919

View in Genome Browser
Species Human (GRCh38)
Location 17:15418190-15418212
Sequence GGTGGGGCAGACACCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144455919_1144455923 -3 Left 1144455919 17:15418190-15418212 CCTACAGGGGTGTCTGCCCCACC No data
Right 1144455923 17:15418210-15418232 ACCTGCCCCACCCCTACAGCAGG No data
1144455919_1144455932 24 Left 1144455919 17:15418190-15418212 CCTACAGGGGTGTCTGCCCCACC No data
Right 1144455932 17:15418237-15418259 GCAAAACCACCTGTGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144455919 Original CRISPR GGTGGGGCAGACACCCCTGT AGG (reversed) Intergenic
No off target data available for this crispr