ID: 1144455919 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:15418190-15418212 |
Sequence | GGTGGGGCAGACACCCCTGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1144455919_1144455923 | -3 | Left | 1144455919 | 17:15418190-15418212 | CCTACAGGGGTGTCTGCCCCACC | No data | ||
Right | 1144455923 | 17:15418210-15418232 | ACCTGCCCCACCCCTACAGCAGG | No data | ||||
1144455919_1144455932 | 24 | Left | 1144455919 | 17:15418190-15418212 | CCTACAGGGGTGTCTGCCCCACC | No data | ||
Right | 1144455932 | 17:15418237-15418259 | GCAAAACCACCTGTGAGCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1144455919 | Original CRISPR | GGTGGGGCAGACACCCCTGT AGG (reversed) | Intergenic | ||