ID: 1144455920

View in Genome Browser
Species Human (GRCh38)
Location 17:15418206-15418228
Sequence CTGTAGGGGTGGGGCAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144455920_1144455936 27 Left 1144455920 17:15418206-15418228 CCCCACCTGCCCCACCCCTACAG No data
Right 1144455936 17:15418256-15418278 GTGGTTGACACTGAACTGCAGGG No data
1144455920_1144455932 8 Left 1144455920 17:15418206-15418228 CCCCACCTGCCCCACCCCTACAG No data
Right 1144455932 17:15418237-15418259 GCAAAACCACCTGTGAGCTGTGG No data
1144455920_1144455937 30 Left 1144455920 17:15418206-15418228 CCCCACCTGCCCCACCCCTACAG No data
Right 1144455937 17:15418259-15418281 GTTGACACTGAACTGCAGGGAGG No data
1144455920_1144455935 26 Left 1144455920 17:15418206-15418228 CCCCACCTGCCCCACCCCTACAG No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144455920 Original CRISPR CTGTAGGGGTGGGGCAGGTG GGG (reversed) Intergenic