ID: 1144455923

View in Genome Browser
Species Human (GRCh38)
Location 17:15418210-15418232
Sequence ACCTGCCCCACCCCTACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144455914_1144455923 12 Left 1144455914 17:15418175-15418197 CCACAGGCGAGGCCTCCTACAGG No data
Right 1144455923 17:15418210-15418232 ACCTGCCCCACCCCTACAGCAGG No data
1144455911_1144455923 25 Left 1144455911 17:15418162-15418184 CCATTAGGACATCCCACAGGCGA No data
Right 1144455923 17:15418210-15418232 ACCTGCCCCACCCCTACAGCAGG No data
1144455918_1144455923 0 Left 1144455918 17:15418187-15418209 CCTCCTACAGGGGTGTCTGCCCC No data
Right 1144455923 17:15418210-15418232 ACCTGCCCCACCCCTACAGCAGG No data
1144455913_1144455923 13 Left 1144455913 17:15418174-15418196 CCCACAGGCGAGGCCTCCTACAG No data
Right 1144455923 17:15418210-15418232 ACCTGCCCCACCCCTACAGCAGG No data
1144455919_1144455923 -3 Left 1144455919 17:15418190-15418212 CCTACAGGGGTGTCTGCCCCACC No data
Right 1144455923 17:15418210-15418232 ACCTGCCCCACCCCTACAGCAGG No data
1144455910_1144455923 26 Left 1144455910 17:15418161-15418183 CCCATTAGGACATCCCACAGGCG No data
Right 1144455923 17:15418210-15418232 ACCTGCCCCACCCCTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144455923 Original CRISPR ACCTGCCCCACCCCTACAGC AGG Intergenic