ID: 1144455925

View in Genome Browser
Species Human (GRCh38)
Location 17:15418215-15418237
Sequence CAGGACCTGCTGTAGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144455925_1144455938 30 Left 1144455925 17:15418215-15418237 CCCCACCCCTACAGCAGGTCCTG No data
Right 1144455938 17:15418268-15418290 GAACTGCAGGGAGGATGCTAAGG No data
1144455925_1144455937 21 Left 1144455925 17:15418215-15418237 CCCCACCCCTACAGCAGGTCCTG No data
Right 1144455937 17:15418259-15418281 GTTGACACTGAACTGCAGGGAGG No data
1144455925_1144455936 18 Left 1144455925 17:15418215-15418237 CCCCACCCCTACAGCAGGTCCTG No data
Right 1144455936 17:15418256-15418278 GTGGTTGACACTGAACTGCAGGG No data
1144455925_1144455932 -1 Left 1144455925 17:15418215-15418237 CCCCACCCCTACAGCAGGTCCTG No data
Right 1144455932 17:15418237-15418259 GCAAAACCACCTGTGAGCTGTGG No data
1144455925_1144455935 17 Left 1144455925 17:15418215-15418237 CCCCACCCCTACAGCAGGTCCTG No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144455925 Original CRISPR CAGGACCTGCTGTAGGGGTG GGG (reversed) Intergenic