ID: 1144455935

View in Genome Browser
Species Human (GRCh38)
Location 17:15418255-15418277
Sequence TGTGGTTGACACTGAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144455924_1144455935 21 Left 1144455924 17:15418211-15418233 CCTGCCCCACCCCTACAGCAGGT No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455920_1144455935 26 Left 1144455920 17:15418206-15418228 CCCCACCTGCCCCACCCCTACAG No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455928_1144455935 12 Left 1144455928 17:15418220-15418242 CCCCTACAGCAGGTCCTGCAAAA No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455931_1144455935 -2 Left 1144455931 17:15418234-15418256 CCTGCAAAACCACCTGTGAGCTG No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455925_1144455935 17 Left 1144455925 17:15418215-15418237 CCCCACCCCTACAGCAGGTCCTG No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455926_1144455935 16 Left 1144455926 17:15418216-15418238 CCCACCCCTACAGCAGGTCCTGC No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455922_1144455935 24 Left 1144455922 17:15418208-15418230 CCACCTGCCCCACCCCTACAGCA No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455921_1144455935 25 Left 1144455921 17:15418207-15418229 CCCACCTGCCCCACCCCTACAGC No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455930_1144455935 10 Left 1144455930 17:15418222-15418244 CCTACAGCAGGTCCTGCAAAACC No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455927_1144455935 15 Left 1144455927 17:15418217-15418239 CCACCCCTACAGCAGGTCCTGCA No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data
1144455929_1144455935 11 Left 1144455929 17:15418221-15418243 CCCTACAGCAGGTCCTGCAAAAC No data
Right 1144455935 17:15418255-15418277 TGTGGTTGACACTGAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144455935 Original CRISPR TGTGGTTGACACTGAACTGC AGG Intergenic