ID: 1144457079

View in Genome Browser
Species Human (GRCh38)
Location 17:15427716-15427738
Sequence TAGGTTTCTAAAGAACCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144457075_1144457079 -7 Left 1144457075 17:15427700-15427722 CCCACCACCATGCACATAGGTTT No data
Right 1144457079 17:15427716-15427738 TAGGTTTCTAAAGAACCTACAGG No data
1144457076_1144457079 -8 Left 1144457076 17:15427701-15427723 CCACCACCATGCACATAGGTTTC No data
Right 1144457079 17:15427716-15427738 TAGGTTTCTAAAGAACCTACAGG No data
1144457071_1144457079 3 Left 1144457071 17:15427690-15427712 CCAGGACTCCCCCACCACCATGC No data
Right 1144457079 17:15427716-15427738 TAGGTTTCTAAAGAACCTACAGG No data
1144457069_1144457079 24 Left 1144457069 17:15427669-15427691 CCTGTTTGTGCATTCTAGAAGCC No data
Right 1144457079 17:15427716-15427738 TAGGTTTCTAAAGAACCTACAGG No data
1144457074_1144457079 -6 Left 1144457074 17:15427699-15427721 CCCCACCACCATGCACATAGGTT No data
Right 1144457079 17:15427716-15427738 TAGGTTTCTAAAGAACCTACAGG No data
1144457073_1144457079 -5 Left 1144457073 17:15427698-15427720 CCCCCACCACCATGCACATAGGT No data
Right 1144457079 17:15427716-15427738 TAGGTTTCTAAAGAACCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144457079 Original CRISPR TAGGTTTCTAAAGAACCTAC AGG Intergenic
No off target data available for this crispr