ID: 1144457863

View in Genome Browser
Species Human (GRCh38)
Location 17:15433597-15433619
Sequence GTCCTAAAGGGGGTCTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144457863_1144457871 3 Left 1144457863 17:15433597-15433619 CCTCTGAAGACCCCCTTTAGGAC No data
Right 1144457871 17:15433623-15433645 AGGATCAAAATCCCTACCTCAGG No data
1144457863_1144457872 4 Left 1144457863 17:15433597-15433619 CCTCTGAAGACCCCCTTTAGGAC No data
Right 1144457872 17:15433624-15433646 GGATCAAAATCCCTACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144457863 Original CRISPR GTCCTAAAGGGGGTCTTCAG AGG (reversed) Intergenic
No off target data available for this crispr