ID: 1144463421

View in Genome Browser
Species Human (GRCh38)
Location 17:15477438-15477460
Sequence CTATTACAGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 313}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144463421 Original CRISPR CTATTACAGCAGAAGGAGGA AGG (reversed) Intronic
900715898 1:4143521-4143543 CTCTTACATAAGAAGGAGTAGGG + Intergenic
901814968 1:11788724-11788746 CAGTTACAGCAGCAGGAAGATGG + Exonic
902249191 1:15142114-15142136 CCATTCCAGCCAAAGGAGGAGGG + Intergenic
902945504 1:19834258-19834280 CAATAACAGCAGAAAGGGGAGGG + Intergenic
903222984 1:21879117-21879139 CAATTCTAGAAGAAGGAGGAGGG + Exonic
904540170 1:31227516-31227538 CAGTTACAGCAGAATGAGGTGGG + Intronic
906096600 1:43228402-43228424 CAATTAGAGAAGATGGAGGAGGG - Intronic
907100236 1:51825997-51826019 CTCATACAGCAGAAGGGGCAAGG - Intronic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
910985240 1:92998869-92998891 CTATTAGAGCAGAAAGATAAAGG - Intergenic
911390335 1:97233350-97233372 CTACTACTGCAGAAGGGGGGAGG + Intronic
912045723 1:105453043-105453065 CTCCTACAGCAAGAGGAGGAGGG + Intergenic
912985105 1:114419755-114419777 CTCTTACAGGAGCAGGGGGATGG + Intronic
913452077 1:118999324-118999346 CTATTAGAGAAGAAGGTGAACGG + Intergenic
915462741 1:156079970-156079992 CTAACACTGCAGCAGGAGGAGGG + Intronic
916846501 1:168656016-168656038 CTATTCCAGGAGTAGGATGAGGG + Intergenic
918783465 1:188732547-188732569 CAATCACAGCAGAAGGTGAAAGG + Intergenic
920210822 1:204327058-204327080 CTATCCCAGGAGGAGGAGGAGGG - Intronic
920757757 1:208750677-208750699 CAATTATAGCAGAAGGTGAAGGG - Intergenic
922346162 1:224698333-224698355 CGATTATAGCACAAGGAGGTAGG + Intronic
922370838 1:224909360-224909382 CAATCACAGCAGAAGGCGAAGGG + Intronic
922863861 1:228842246-228842268 CCATTCCAGCAGGAGGAGGGAGG + Intergenic
1063001536 10:1928681-1928703 CCATTAGAGCAAAGGGAGGAGGG + Intergenic
1064214806 10:13391383-13391405 CAATTACAGCAGAAGGCGAAAGG - Intergenic
1064813505 10:19230113-19230135 CAATTATAGCAGAAGGCGAAAGG - Intronic
1064921616 10:20525516-20525538 ATATTCCAGCAGATGGAGGCAGG - Intergenic
1065024942 10:21533431-21533453 GTATTACACCAAAAGGAAGAAGG - Intergenic
1067152516 10:43748586-43748608 TTATTACAGTGAAAGGAGGAGGG + Intergenic
1069380905 10:67842527-67842549 CAATCACAGCAGAAGGTGAAGGG - Intergenic
1070022189 10:72597779-72597801 ATATTGCAGCTGAAGGAGGCTGG + Intronic
1071239675 10:83691857-83691879 CTGTCACTGCAGAAGGGGGAGGG - Intergenic
1071394570 10:85208912-85208934 CAATCATGGCAGAAGGAGGAAGG + Intergenic
1072715746 10:97751353-97751375 CTATGACAGAAGGAGAAGGATGG - Intronic
1072943119 10:99785267-99785289 CACTCACAGTAGAAGGAGGAGGG + Intronic
1073267199 10:102234872-102234894 TTATTTCAGCAGAGGGAGGCAGG + Intronic
1073628139 10:105120235-105120257 CAATCACAGCAGAAGGTGAAGGG - Intronic
1075818528 10:125285177-125285199 TGATTACAGTGGAAGGAGGAGGG + Intergenic
1076459346 10:130629200-130629222 CTATTAAGGGAGAAGGAGGGAGG + Intergenic
1078047120 11:7925084-7925106 CTATTAAAGAAAAAGGAGAATGG + Intergenic
1078334750 11:10454790-10454812 CTATTCTGCCAGAAGGAGGAGGG - Intronic
1078818888 11:14855919-14855941 GTATTTCAGCAGAAGAAGGGTGG + Intronic
1079674578 11:23209799-23209821 TTATTACAGAAAAAGGATGAGGG - Intergenic
1080804123 11:35636318-35636340 CTCTTCCAGCAGAGAGAGGAGGG + Intergenic
1081051603 11:38349101-38349123 CAATTATAGCAAAAGGAGAAGGG + Intergenic
1081120388 11:39257967-39257989 CAATCACAGCAGAAGGTGAAAGG - Intergenic
1081303044 11:41477024-41477046 CTGTTACAGAATGAGGAGGAGGG + Intergenic
1083513871 11:63237454-63237476 ATCTCACAGCAGAAGGTGGAAGG - Intronic
1083738527 11:64695230-64695252 CTTTTCCAGCAGTGGGAGGAGGG - Intronic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1085022318 11:73217576-73217598 CTAGGACAGCAGCAGGAAGAAGG + Intergenic
1085856716 11:80183479-80183501 ATAATACAGCGGAAGTAGGATGG + Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087450649 11:98317696-98317718 GGATTCCAGCTGAAGGAGGAAGG - Intergenic
1088748371 11:112823240-112823262 CTGTTATAGCAGAAGGAGACAGG + Intergenic
1089534348 11:119151357-119151379 CCAGTACAGCAGAATGAGGCTGG - Intronic
1089718196 11:120384596-120384618 CTCTTACAGTAGAATGAGGGAGG - Intronic
1090601931 11:128381324-128381346 CGATTAGAGCAGAAGGACAAAGG - Intergenic
1090887781 11:130894379-130894401 GCATTAGAGCAGAAGGAAGAAGG + Intronic
1091760197 12:3082246-3082268 GCATTTCAACAGAAGGAGGAAGG + Intronic
1091824265 12:3498792-3498814 TTATTACAGCAGACCTAGGAGGG - Intronic
1091854706 12:3730155-3730177 TTTTTCCAGCAGAGGGAGGAGGG - Intronic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1094501201 12:31022562-31022584 CTATTACAGAAAAAGGAAAAGGG + Intergenic
1094707289 12:32926509-32926531 CTATTCTAGTAGAATGAGGAGGG + Intergenic
1095854345 12:46843855-46843877 CTTTTATGGCAGGAGGAGGAAGG - Intergenic
1097139426 12:56887408-56887430 CAATCACAGCAGAAGGTGAAGGG - Intergenic
1098652422 12:72990106-72990128 CTAGAACAGGAGTAGGAGGAAGG - Intergenic
1099540002 12:83895937-83895959 CAATCACAGCAGAAGGTGAAGGG - Intergenic
1101082188 12:101198736-101198758 CTATTTCAGAAAATGGAGGAGGG + Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1103024286 12:117560879-117560901 GTCTTATAGCAGAAGGAGAAGGG - Intronic
1103826188 12:123740786-123740808 CTCTTACGGCAGTATGAGGAAGG + Intronic
1106541564 13:30695204-30695226 CTTATACAGCAGAGGGTGGAGGG - Intergenic
1106922960 13:34583982-34584004 CTTTTACAGCTAAAAGAGGAAGG + Intergenic
1107101985 13:36603135-36603157 CAATCACAGCAGAAGGCGAAGGG + Intergenic
1108735337 13:53278079-53278101 CTATTATGGCAGAAGGTGAAGGG + Intergenic
1109528323 13:63605850-63605872 GGACTACAGCAGAAGGAGGCTGG - Intergenic
1110190418 13:72723991-72724013 CTAATACAGAGGCAGGAGGAAGG + Intronic
1110268544 13:73567478-73567500 CTAATACAGCAGAAGGAATGGGG + Intergenic
1110906711 13:80898581-80898603 CTATTACAGAAGAAGGCTGGGGG + Intergenic
1111051316 13:82885642-82885664 GCATGACAGCAGCAGGAGGAAGG + Intergenic
1111671267 13:91333319-91333341 CAATTACAGCAGAAGGCGAAGGG + Intergenic
1111785334 13:92779124-92779146 CAATCACAGCAGAAGGAGAAAGG + Intronic
1111922059 13:94422657-94422679 ATATTGCAGCCGAAGGGGGATGG + Intergenic
1113044002 13:106134280-106134302 GTATTACAGCAGCAACAGGAAGG + Intergenic
1113496857 13:110737764-110737786 CAATCATAGCAGAAGGAGAAGGG - Intergenic
1115507990 14:34111023-34111045 CAATCACAGCAGAAGGCGAAAGG - Intronic
1117446132 14:55805372-55805394 CTATGACAGGAAGAGGAGGAAGG - Intergenic
1118083668 14:62390864-62390886 CTATTAGAGGAGAGAGAGGAAGG + Intergenic
1118740107 14:68733322-68733344 CAGTTACAGCAGAAGCTGGAAGG + Intergenic
1118998925 14:70863214-70863236 CAATCATGGCAGAAGGAGGAGGG + Intergenic
1120253867 14:82093179-82093201 CAATCACAGCAGAAGGCGAAGGG - Intergenic
1120281141 14:82439352-82439374 CAATTACAGCAGAAGGTGAAGGG - Intergenic
1120567996 14:86083031-86083053 CAATCACAGCAGAAGGTGAAGGG + Intergenic
1123026130 14:105425121-105425143 CAAGTTCAGCAGGAGGAGGAAGG - Intronic
1123093613 14:105753629-105753651 CAATCACAGCAGAAGGCGAAGGG - Intergenic
1123428224 15:20190629-20190651 CAATCACAGCAGAAGGTGAAGGG - Intergenic
1125048080 15:35266330-35266352 CTATTATAGCAGGAGGGGAAAGG + Intronic
1125274099 15:37972160-37972182 CAATTACAGCAGAAGGCCAAAGG + Intergenic
1126939877 15:53755703-53755725 CCATTACCGCAGAAAGAGAAGGG + Intronic
1128480578 15:68034284-68034306 TTATCACAGCAGGAAGAGGACGG + Intergenic
1130070386 15:80642148-80642170 CTATTACAGATGAAGAAGAAAGG - Intergenic
1130147668 15:81286870-81286892 CAATCACAGCAGAAGGTGAAAGG + Intronic
1130233106 15:82111728-82111750 CTAACACAGCAGAAGGCTGAAGG + Intergenic
1130603138 15:85291642-85291664 ATATAACTGGAGAAGGAGGAGGG + Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1131674077 15:94653446-94653468 ATACTGCAGCAGAAGGAGCATGG - Intergenic
1132354413 15:101160502-101160524 CTATTGCTGGAGATGGAGGAGGG + Intergenic
1133427110 16:5702232-5702254 CAATTATAGCAGAAGGTGAATGG + Intergenic
1133653825 16:7839765-7839787 CTAGTACAGCAGAGGCTGGAAGG - Intergenic
1134067571 16:11238941-11238963 CTCATATAGCGGAAGGAGGAGGG + Intergenic
1134221631 16:12359291-12359313 GTATGACAGCAGAAGGAAAATGG + Intronic
1134409964 16:13995691-13995713 CAATCACAGCAGAAGGTGAAGGG + Intergenic
1134863441 16:17582740-17582762 TTATTAAAGTAGAATGAGGATGG + Intergenic
1136856094 16:33659121-33659143 CAATCACAGCAGAAGGTGAAGGG + Intergenic
1137932695 16:52603782-52603804 TAATTCCTGCAGAAGGAGGAAGG + Intergenic
1138680177 16:58678469-58678491 CTATAACTGCACAGGGAGGAAGG + Exonic
1140388196 16:74561148-74561170 CTCTGACACCAGCAGGAGGAAGG - Intronic
1141124633 16:81392412-81392434 CTATTCCAGCTGAAGGACGGTGG - Intergenic
1142199875 16:88755982-88756004 CCAGGACAGCAGAAGAAGGAAGG + Intronic
1203117680 16_KI270728v1_random:1507600-1507622 CAATCACAGCAGAAGGTGAAGGG + Intergenic
1143588338 17:7863736-7863758 CTATTTCAGGAGTAGGAGTAGGG - Intronic
1143947359 17:10605071-10605093 CTATTACTCCAGAAAGAGGGTGG - Intergenic
1144463421 17:15477438-15477460 CTATTACAGCAGAAGGAGGAAGG - Intronic
1147252443 17:39161135-39161157 CTATACCAGCAGCATGAGGAGGG - Intronic
1147437093 17:40423223-40423245 CTTTCCCAGCAGAAGGAGGCTGG + Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148538114 17:48457512-48457534 TTATTACTCCAGGAGGAGGAGGG - Intergenic
1151485007 17:74393553-74393575 CTTTGACAGCAGATGGATGATGG - Intergenic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1153062038 18:1004765-1004787 CTATTATACCACAAGGAGGAAGG - Intergenic
1153268344 18:3294522-3294544 CTCTTACAGGAGAAGAGGGAAGG + Intergenic
1154935086 18:21046544-21046566 CTAACACAGAAGTAGGAGGAAGG + Intronic
1155078205 18:22381633-22381655 AGAGTCCAGCAGAAGGAGGAAGG - Intergenic
1155395845 18:25386098-25386120 CTTTTACAGCCGATGGATGAAGG - Intergenic
1156747534 18:40410629-40410651 TTGTTAGAGCAGAAGGAGAAAGG - Intergenic
1157044255 18:44079852-44079874 CTATTACTAAAGAAGGAGAAAGG + Intergenic
1158269063 18:55693249-55693271 CAATTATGGCAGAAGGAGAAGGG + Intergenic
1161762604 19:6185470-6185492 CTGTTCCAGCAGAACAAGGATGG + Exonic
1162424168 19:10583982-10584004 CTGGTACAGCGGGAGGAGGAAGG - Exonic
1162774025 19:12968103-12968125 ATATTACAGAAGAAGAAGGTAGG + Intronic
1162969428 19:14171148-14171170 CAATCACAGCAGAAGGTGAAGGG - Intronic
1163647077 19:18495570-18495592 CCACTGCAGCTGAAGGAGGAGGG + Intronic
1164061463 19:21679173-21679195 CTACTAGAGCAGAGGGAGGCTGG + Intergenic
1164300524 19:23957892-23957914 CAATTACAGCTGAACGGGGAAGG + Intergenic
1164406815 19:27955909-27955931 GTTTTGCAGCAGAAGGAGCAGGG + Intergenic
1164769820 19:30799954-30799976 CTCGTGCAGCAGGAGGAGGAGGG - Intergenic
1165637554 19:37354849-37354871 AAATCACAGCAGAAAGAGGAAGG - Intronic
1165848059 19:38831655-38831677 CTGTTATAGCAGATGTAGGACGG - Intronic
927751092 2:25671995-25672017 CTATTACTTGAGAAGGAAGAGGG - Intronic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
929070943 2:38029881-38029903 CAATCACGGCAGAAGGTGGAAGG + Intronic
929163831 2:38860570-38860592 CTAGTACACCAAAAGCAGGAGGG + Intronic
929243181 2:39673723-39673745 CTGTTACAGCAGAACTAGCAGGG + Intronic
929437121 2:41937526-41937548 CCATTACACCAGGAGGAGGAGGG + Exonic
929815523 2:45228116-45228138 CGATCACAGCAGAAGGTGAAAGG - Intergenic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930562200 2:52973769-52973791 CAATTACAGCAGAAGGCTAAGGG - Intergenic
930667193 2:54111078-54111100 CTCTTTCAGCAGAAAGAGGTTGG + Intronic
931279875 2:60780901-60780923 AAACCACAGCAGAAGGAGGAAGG - Intronic
931579297 2:63755428-63755450 TTATTACAGTGGAAGGAGGAGGG + Intronic
932644939 2:73490316-73490338 CTATTTTAGCAGAAGGTAGAAGG + Exonic
934164767 2:89283960-89283982 CGATGACAGAAGAAGGAAGAAGG + Intergenic
934202507 2:89898564-89898586 CGATGACAGAAGAAGGAAGAAGG - Intergenic
934601945 2:95664336-95664358 CTATAAAAGCAGAAGTCGGATGG + Intergenic
935965863 2:108474815-108474837 TTATTGCTGCAGAAGAAGGAGGG + Intronic
936055775 2:109260897-109260919 CTCTCACAGCAGAGGCAGGATGG - Intronic
936913553 2:117616616-117616638 CTAGTACAGGAGAGTGAGGAGGG + Intergenic
937086443 2:119174894-119174916 CTAGAACGGCAGAGGGAGGAGGG + Intergenic
937616187 2:123924538-123924560 CAATCACAGCAGAAGGTGAAGGG + Intergenic
939552633 2:143634661-143634683 ATATTAAAGCAGAATGAAGATGG - Intronic
941358131 2:164517139-164517161 CAATCACAGCAGAAGGTGAAAGG + Intronic
941918545 2:170828051-170828073 GGAGGACAGCAGAAGGAGGAGGG - Intronic
941918554 2:170828089-170828111 GGAGGACAGCAGAAGGAGGAGGG - Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942815465 2:180048336-180048358 ATATTGCAGCTGCAGGAGGATGG - Intergenic
945036630 2:205709092-205709114 CTAAGACAGCAGATGGAGGACGG + Intronic
945431487 2:209771146-209771168 CTATTACAACTGAAGGAAAATGG + Intergenic
946698988 2:222391850-222391872 GTATTACAGCTGAAGGGGGCTGG - Intergenic
946820765 2:223627120-223627142 TTTTTACAGCAGCAAGAGGAAGG + Intergenic
947479545 2:230486132-230486154 CAATTACAGCGGAAGGTGAAGGG + Intronic
948733446 2:239982020-239982042 CTATTAGAGCAGAAGGTAGTTGG - Intronic
1169865431 20:10194976-10194998 CTATTTCAGGAGAAGCAAGAGGG - Intergenic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1170553740 20:17499070-17499092 CTCTTAGAGAAGAAGGGGGATGG - Intronic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1173810855 20:45954213-45954235 TTATCACAGCAGGAGGGGGATGG + Intronic
1173981945 20:47231227-47231249 CCATTACAGCAGAAAGAGGAGGG + Intronic
1174128760 20:48327240-48327262 CTAATACAGAAGCCGGAGGAAGG + Intergenic
1174442813 20:50569442-50569464 CTATTCCAACAGAGTGAGGAGGG - Intronic
1175019727 20:55832177-55832199 ATATTCCATCATAAGGAGGAAGG - Intergenic
1176292850 21:5055422-5055444 CTATCACAGCAGAAAGGGAAGGG - Intergenic
1178438906 21:32582991-32583013 CTACTACAGCAAAAAGAGGCTGG + Intronic
1179864410 21:44208228-44208250 CTATCACAGCAGAAAGGGAAGGG + Intergenic
1181435786 22:22910044-22910066 CTAAGACAACACAAGGAGGACGG + Intergenic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1182995491 22:34808302-34808324 ATATGACAGCAGCAGGGGGATGG - Intergenic
1183060167 22:35331581-35331603 CTATTACAAAAGAAGGAGAAGGG + Intronic
1184360719 22:44016658-44016680 ATATTACAGCTGAAGGGGGCTGG + Intronic
1184600208 22:45539035-45539057 GGAATACAGCAGCAGGAGGAGGG - Intronic
1185167888 22:49272893-49272915 CCCATGCAGCAGAAGGAGGAGGG + Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949248202 3:1950163-1950185 CTAACACGGCAGAAGGTGGAAGG + Intergenic
949965677 3:9354108-9354130 CTATAATGGCAGAAGAAGGAAGG + Intronic
950972313 3:17201590-17201612 GTGTTACAGCAGAGGCAGGATGG + Intronic
953336447 3:42098360-42098382 CTTTTCCAGCACATGGAGGAAGG + Intronic
953567073 3:44041997-44042019 CAATAACAGCCAAAGGAGGAGGG + Intergenic
953664932 3:44918585-44918607 CAAACACAGCAGAAGGACGATGG + Intronic
957015994 3:75065697-75065719 CTATTACACAAGATGGAGAAAGG - Intergenic
958716477 3:97788903-97788925 CTCTTACAGCAGAGAGAGGTAGG - Intronic
959164252 3:102757513-102757535 TTATTACAACAGAATAAGGATGG + Intergenic
960466137 3:117998165-117998187 CTATTACAGCTACACGAGGATGG + Intergenic
961766871 3:129218298-129218320 CTTTTTCTGCAGAAGGATGAGGG + Intergenic
965355194 3:167664743-167664765 CTCTTACAGCATAGGGAGAAGGG + Intergenic
965782666 3:172304288-172304310 ATAATAGAGCAGAGGGAGGAAGG - Intronic
965969024 3:174530611-174530633 CAATCACAGCAGAAGGTGAAAGG + Intronic
966118628 3:176496406-176496428 CAATCACAGCAGAAGGTGAAGGG - Intergenic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
966796219 3:183716532-183716554 AAATTACAGCTGAATGAGGAGGG - Intronic
966989191 3:185211452-185211474 CCATTACAGCAGAAGAAGAAGGG - Intronic
967111149 3:186295161-186295183 GTACTACAGCTGAAGGAGAAGGG - Intronic
967137521 3:186524933-186524955 CTCTTACAACAGAAGGGGAAGGG + Intergenic
968190501 3:196663845-196663867 TTATTTCAGCAGAAGGTGGCAGG - Intronic
969907787 4:10413460-10413482 ATATGACAGCAGAACGTGGAGGG - Intergenic
972869377 4:43277935-43277957 ATATTACAGCAGCTTGAGGATGG - Intergenic
974218620 4:58934743-58934765 ATATTGCAGCTGAAAGAGGATGG - Intergenic
974954137 4:68617708-68617730 GACTTACTGCAGAAGGAGGATGG - Intronic
976334603 4:83870904-83870926 CTAATACGGCAGAAGGATAAGGG + Intergenic
976502984 4:85813967-85813989 CAATTACAGCAGAAGGTGAAAGG + Intronic
977086478 4:92605063-92605085 CAATCATAGCAGAAGGTGGAGGG - Intronic
978666935 4:111195191-111195213 CAATCATAGCAGAAGGTGGAGGG - Intergenic
979003756 4:115261360-115261382 CAATCACAGCAGAAGGTGAAGGG - Intergenic
979853383 4:125601349-125601371 CTATTACAACAGAAAGATGTGGG - Intergenic
983200342 4:164854280-164854302 ATATTATAGCAAAAGTAGGAGGG + Intergenic
983302889 4:165949612-165949634 CAATCACAGCAGAAGGTGAAAGG + Intronic
983391793 4:167141157-167141179 CAATTACACCAGGAGAAGGATGG + Intronic
984577821 4:181472308-181472330 GTATTATGGCAGAAGGTGGAAGG + Intergenic
985365775 4:189231075-189231097 CAATTGTAGCAGAAGGTGGAGGG + Intergenic
986106297 5:4662551-4662573 TTGTTACAGGAGAAGGAGCAAGG + Intergenic
987030840 5:13975179-13975201 CAATTATGGCAGAAGGAGAAAGG + Intergenic
988640080 5:33032281-33032303 ACATTACAGCAGATGCAGGAGGG - Intergenic
988737403 5:34036043-34036065 CTGTTACAGTAGCAGCAGGAAGG - Intronic
989306215 5:39959763-39959785 CAATGATAGCAGAAGGATGAAGG - Intergenic
989403631 5:41036380-41036402 CAATCACAGCAGAAGGTGAAAGG - Intronic
991009767 5:61870735-61870757 CTATGATAGCAGATGGAGGCAGG - Intergenic
991045751 5:62220962-62220984 CAATCACAGCAGAAGGTGAAGGG - Intergenic
992819985 5:80486863-80486885 TTATTCCAGCATAAGAAGGAAGG + Intergenic
993086401 5:83368574-83368596 CTAATACAGCAGAAGGGAGTGGG + Intergenic
993728877 5:91398982-91399004 CGTTTACAGAAGAAGGAGAATGG + Intergenic
994076252 5:95653243-95653265 CTATTACAGCAAGAGAAGGTGGG - Intronic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
995062287 5:107823781-107823803 CAATCACAGCAGAAGGAGAAGGG - Intergenic
995293891 5:110494994-110495016 CTATGAAAGCAGTAGGAGAATGG + Intronic
995403698 5:111769681-111769703 CAATTATAGCAGAAGGCGAAGGG + Intronic
995533386 5:113112466-113112488 CAATTACGGCAGAAGGTGAAGGG - Intronic
995605015 5:113844883-113844905 CTATTTCAGAATAAGCAGGATGG - Intergenic
997159788 5:131595321-131595343 CAATCACAGCAGAAGGTGAAGGG - Intronic
999283499 5:150380179-150380201 GGATGACAGCAGACGGAGGAGGG - Intronic
999437656 5:151576107-151576129 CTATTAAAGCAGAATGAAAAGGG + Intergenic
1002351763 5:178588947-178588969 CTATCCCAGGAGAAGGAGGAAGG + Intronic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1008560486 6:52720079-52720101 CAATTACAGCAGAAGGCAAAAGG - Intergenic
1009050097 6:58264720-58264742 ATATTAAGGCAGAAAGAGGATGG - Intergenic
1009467982 6:63997178-63997200 TTATTACAGTAGGAGGATGATGG - Intronic
1011172124 6:84516839-84516861 CAATTACAGCAGAAGGCAAAGGG - Intergenic
1011366743 6:86590646-86590668 CTATAACAGCAGGTGAAGGAAGG + Intergenic
1011474614 6:87739097-87739119 CTATCTCAGCAGAAGAAAGAGGG - Intergenic
1011645679 6:89455730-89455752 CAATTATAGCAGAAGGTGAAGGG - Intronic
1013455919 6:110329680-110329702 CAATTACAGGAGAAGGCTGAGGG - Intronic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016449800 6:144170391-144170413 GTATTGCAGCTGAAGGGGGATGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019362587 7:612594-612616 CTATTAGAGGAGAGGAAGGAAGG + Intronic
1020747775 7:12099482-12099504 CAATCACAGCAGAAAGATGAAGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022654080 7:32303026-32303048 CAATTACAGCCAAAGGAGCAAGG - Intergenic
1023337235 7:39183239-39183261 CTAATACAGCAGGTGGGGGATGG - Intronic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1025176982 7:56807045-56807067 CTCTTGCACCAGAAGGTGGAAGG - Intergenic
1025694810 7:63769341-63769363 CTCTTGCACCAGAAGGTGGAAGG + Intergenic
1029058066 7:97767461-97767483 CAATAACAGCAGAAGGAAGATGG - Intergenic
1029728006 7:102420885-102420907 GTATTGCAGCTGAAGGAGGCTGG - Intronic
1030085230 7:105810250-105810272 CTTTCACAGCAGGAAGAGGATGG + Intronic
1030956909 7:115864240-115864262 GAAGTACAGCAGCAGGAGGATGG - Intergenic
1031137576 7:117901595-117901617 CTGTGACAGCACAAGGAGCAAGG + Intergenic
1032560220 7:132883077-132883099 CAATTACGGCAGAAGGTGAAAGG - Intronic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038707196 8:29905572-29905594 CTGTTACAGCAGCAGCAGTAAGG - Intergenic
1041451121 8:58007647-58007669 CTCACACAGCTGAAGGAGGAGGG - Intronic
1043751790 8:83945654-83945676 AAATAACAGCATAAGGAGGAAGG + Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1045061949 8:98418528-98418550 CTTTCACAGCAGAAGGGCGAGGG + Intronic
1045439962 8:102199448-102199470 CAATCACAGCAGAAGGTGAAGGG + Intergenic
1046300289 8:112277739-112277761 CAATTATAGCAGAAGGAGAAAGG + Intronic
1047022988 8:120796190-120796212 CAATTATGGCAGAAGGAGAAGGG - Intronic
1047350305 8:124067296-124067318 CCATTGCAGCAAAAGGAGGGAGG - Intronic
1047451676 8:124970614-124970636 ATATTTCAGCAGAAGTATGAAGG - Intergenic
1047826093 8:128577386-128577408 CTATTACAACAGCATGAGGTAGG + Intergenic
1047994315 8:130318913-130318935 CTACTACAGGAGAAGTGGGAAGG + Intronic
1049144076 8:140984812-140984834 CTATTACTCTAGGAGGAGGAAGG - Intronic
1050256727 9:3800339-3800361 ATATTGCAGCTGAAGTAGGAAGG - Intergenic
1050465314 9:5916667-5916689 CTAACACACCAGAAGGAGGCAGG + Intronic
1052155256 9:25179500-25179522 CTTTCACAGCAGAAGGGAGAGGG + Intergenic
1052208186 9:25869178-25869200 CAATTATAGCAGAAGGTGAAGGG + Intergenic
1052733486 9:32316544-32316566 CAATCACAGCAGAAGGTGAAAGG + Intergenic
1052862205 9:33444021-33444043 CAATTACAGCAGAAGGGGTTTGG - Intronic
1054840335 9:69731621-69731643 CTACTAAAGCAGAATGAGGGTGG - Intronic
1056285488 9:85083549-85083571 CAATCACGGCAGAAGGAGAAAGG + Intergenic
1058890397 9:109356058-109356080 GTATTACAGAAGAAGGACCATGG + Intergenic
1060859877 9:126945615-126945637 CAAGTACAGCAGAAAGGGGAAGG - Intronic
1203769338 EBV:40948-40970 CCATTAAAACGGAAGGAGGAAGG - Intergenic
1203789616 EBV:143867-143889 CCATTAAAACGGAAGGAGGAAGG - Intergenic
1186651780 X:11569084-11569106 CTAGTAGAGCAGAAGAAAGAGGG + Intronic
1187641516 X:21295835-21295857 CTTTGACTGCAGCAGGAGGATGG - Intergenic
1188358110 X:29217408-29217430 CTGTTACAGCAGAAGAATCATGG + Intronic
1188697220 X:33208803-33208825 ATATTACAATAGAAGGTGGAAGG + Intronic
1190973136 X:55371985-55372007 CTTATATGGCAGAAGGAGGAAGG + Intergenic
1192012888 X:67293971-67293993 CCATTACAGAAGAAGCAGAAGGG - Intergenic
1193777051 X:85656407-85656429 CAATCACAGCAGAAGGTGAAGGG - Intergenic
1195038862 X:100995310-100995332 TTATTACAGCTGAAGGAATAAGG - Intergenic
1195366605 X:104132589-104132611 TTGTTACATCTGAAGGAGGATGG - Intronic
1198039416 X:132835345-132835367 ATATAACAGAAGGAGGAGGACGG + Intronic
1198690561 X:139279663-139279685 CTATTACAGCTGAGGGATGGAGG - Intergenic
1199508106 X:148589098-148589120 CTCTTTCAGCATAAGGAGGGAGG + Intronic
1200008580 X:153104557-153104579 CAATCACAGCAGAAGGTGAAAGG - Intergenic
1200356801 X:155561249-155561271 CAATCACAGCAGAAGGTGAAGGG + Intronic
1200503277 Y:3979362-3979384 CTATTCCAATAGATGGAGGAGGG - Intergenic
1201649591 Y:16270690-16270712 CAATCACAGCAGAAGGAGAAAGG - Intergenic
1202381596 Y:24279423-24279445 CTCTTGCACCAGAAGGTGGAAGG + Intergenic
1202489189 Y:25390703-25390725 CTCTTGCACCAGAAGGTGGAAGG - Intergenic