ID: 1144466813

View in Genome Browser
Species Human (GRCh38)
Location 17:15503814-15503836
Sequence TGTTTGGGATAGAACTTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144466813_1144466820 9 Left 1144466813 17:15503814-15503836 CCACCGAAGTTCTATCCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1144466820 17:15503846-15503868 TCTTGTAGGATGGTGAGTTATGG 0: 1
1: 0
2: 0
3: 16
4: 154
1144466813_1144466821 13 Left 1144466813 17:15503814-15503836 CCACCGAAGTTCTATCCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1144466821 17:15503850-15503872 GTAGGATGGTGAGTTATGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 125
1144466813_1144466823 21 Left 1144466813 17:15503814-15503836 CCACCGAAGTTCTATCCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1144466823 17:15503858-15503880 GTGAGTTATGGTAGGGTTCTAGG 0: 1
1: 0
2: 2
3: 11
4: 115
1144466813_1144466826 30 Left 1144466813 17:15503814-15503836 CCACCGAAGTTCTATCCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1144466826 17:15503867-15503889 GGTAGGGTTCTAGGAGGAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 246
1144466813_1144466822 14 Left 1144466813 17:15503814-15503836 CCACCGAAGTTCTATCCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1144466822 17:15503851-15503873 TAGGATGGTGAGTTATGGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1144466813_1144466824 24 Left 1144466813 17:15503814-15503836 CCACCGAAGTTCTATCCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1144466824 17:15503861-15503883 AGTTATGGTAGGGTTCTAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
1144466813_1144466825 29 Left 1144466813 17:15503814-15503836 CCACCGAAGTTCTATCCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1144466825 17:15503866-15503888 TGGTAGGGTTCTAGGAGGAGTGG 0: 1
1: 0
2: 2
3: 22
4: 231
1144466813_1144466818 -5 Left 1144466813 17:15503814-15503836 CCACCGAAGTTCTATCCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1144466818 17:15503832-15503854 AAACAGAAGGAAGCTCTTGTAGG 0: 1
1: 0
2: 1
3: 26
4: 306
1144466813_1144466819 -1 Left 1144466813 17:15503814-15503836 CCACCGAAGTTCTATCCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1144466819 17:15503836-15503858 AGAAGGAAGCTCTTGTAGGATGG 0: 1
1: 0
2: 3
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144466813 Original CRISPR TGTTTGGGATAGAACTTCGG TGG (reversed) Intronic
900599715 1:3497814-3497836 TGCTTGGGGTACAACTTGGGCGG - Intronic
900792834 1:4691205-4691227 TGTTTGGGAAAGAGCATCTGGGG + Intronic
903008327 1:20312959-20312981 TGTTGGGGATCGAACATGGGAGG - Exonic
909414756 1:75393079-75393101 GGTTTGGGATAGAACTATTGAGG - Intronic
909884110 1:80918987-80919009 TCTTTGGGATAGAATGTTGGGGG + Intergenic
911412283 1:97524779-97524801 AGTTAGGGATAGAAATTTGGGGG - Intronic
1064386187 10:14893840-14893862 TATTTGGGAAATAACTTCAGTGG + Intronic
1066230543 10:33428637-33428659 TCTTTGGGATATAATTTTGGGGG - Intergenic
1069384784 10:67874423-67874445 TTGTTGGGGTCGAACTTCGGTGG - Intergenic
1072652970 10:97309933-97309955 TTGTTGGGGTCGAACTTCGGCGG + Intergenic
1075950386 10:126472518-126472540 TGTTTGGGAGTGGACTTGGGTGG + Intronic
1081891285 11:46544676-46544698 TGTTTTGGATAGTACTTCTTTGG - Intronic
1083514148 11:63241091-63241113 TGGTTGGGAAAGAAATTCTGAGG + Intronic
1085198244 11:74684969-74684991 TGTTTGGGATTGAACAGGGGTGG - Intergenic
1094002379 12:25708714-25708736 TTTTGGGGATAGGACTTTGGGGG - Intergenic
1094282660 12:28756663-28756685 TTTTTTGGATACAACTTCAGAGG - Intergenic
1102270779 12:111533169-111533191 TGTATGGAACAGAACTTAGGAGG + Intronic
1104212406 12:126702028-126702050 TGTTTGGGATAAAAATGCAGTGG - Intergenic
1105953603 13:25257255-25257277 TGGTTGGGATAGGACTTCCCAGG - Exonic
1108939314 13:55932497-55932519 AGTTTGGGATAGCACTTGGGAGG - Intergenic
1112105826 13:96238147-96238169 TGTTTAGGAAAGAACTCTGGGGG + Intronic
1119709922 14:76814242-76814264 TGTTTGGGGTAGAAGATTGGGGG - Intronic
1122231797 14:100309828-100309850 TGTTTGGGCCAGGACTTGGGGGG + Intergenic
1138508806 16:57495460-57495482 TGTTTTGGATATAACTTCCAGGG + Intergenic
1144466813 17:15503814-15503836 TGTTTGGGATAGAACTTCGGTGG - Intronic
1146704184 17:34988312-34988334 TGTTGGGGATGGAATTTGGGAGG + Intronic
1149623042 17:58060431-58060453 TGTGTAGGAGAGAACTTGGGGGG - Intergenic
1155535561 18:26812849-26812871 TGTCTGGAAAAGAACTTCAGGGG - Intergenic
1158006058 18:52673132-52673154 TGTTTAGGAAAGAAATTCAGTGG + Intronic
1159358572 18:67370035-67370057 TGTCAGATATAGAACTTCGGTGG + Intergenic
929711400 2:44270624-44270646 TCATTGGGGTGGAACTTCGGCGG - Intergenic
930095407 2:47562608-47562630 GGTTTGGGGTAGAACTTCCTGGG + Intronic
931954604 2:67407077-67407099 TGCTTCGGATAGAAATTTGGTGG - Intronic
944454558 2:199879552-199879574 TGCTTGGGATAGAATTCTGGAGG + Intergenic
944796447 2:203190783-203190805 TCGTTGGGGTCGAACTTCGGCGG - Intronic
946936885 2:224731367-224731389 AGTTTGTGATTGAACTTCTGGGG + Intergenic
946999292 2:225435149-225435171 TGTCTGGGATATAAATTCAGAGG - Intronic
1170116142 20:12862184-12862206 TGTTTGGAATATAACCTCTGGGG + Intergenic
1174953888 20:55074647-55074669 TCGTTGGGGTCGAACTTCGGCGG - Intergenic
949267943 3:2182116-2182138 TGTTTTGGACAGTACTTCTGAGG + Intronic
949742185 3:7249139-7249161 TGTTTGGGATAAAACTTCCATGG + Intronic
956205450 3:66750297-66750319 TCTTTGGGATAGAAACTCTGGGG + Intergenic
960295145 3:115933878-115933900 TGTTTGGGATAGAAGTCAGCAGG + Intronic
962581057 3:136798257-136798279 TTTTTGGCATATAACTTAGGAGG - Intergenic
984431828 4:179660549-179660571 TGTTTGGGAGAGAACAACAGGGG + Intergenic
987884283 5:23793509-23793531 TGTTTTGGATACCACATCGGGGG - Intergenic
990088975 5:52017056-52017078 TGTTTGGGATAGAACAATGTAGG + Intronic
991335277 5:65540088-65540110 TGTTTGGGAAAGAACTTAAAGGG - Intronic
997868032 5:137482077-137482099 TGTCGGGGATAGAAATTGGGAGG + Intronic
1006332284 6:33400531-33400553 TCGTTGGGGTCGAACTTCGGTGG + Intronic
1015294409 6:131574384-131574406 TGTTTGGGAGAGACTTTTGGAGG - Intronic
1015981168 6:138840278-138840300 TGTTTGGGTTTGAACTGCGTGGG - Intronic
1016494121 6:144640349-144640371 TGTTTGGGACTGGACTTTGGCGG - Intronic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1033936916 7:146597127-146597149 TGTTCTGGATAGAACTTCATAGG + Intronic
1046134784 8:110011690-110011712 TGTCTCAGATAAAACTTCGGGGG + Intergenic
1055327662 9:75148754-75148776 TGTTTTGGAAATAACTTCAGAGG + Intergenic
1058105856 9:100971099-100971121 TATTGGGGATAGAACTCAGGTGG + Intergenic
1059551928 9:115237669-115237691 AGCTTGGGATAGGACTTCTGTGG + Intronic
1060925230 9:127451292-127451314 TCGTTGGGGTCGAACTTCGGCGG + Exonic
1186885022 X:13904446-13904468 TGTGGGGGATAGAACTCAGGAGG - Intronic
1196059510 X:111392133-111392155 TGTTTAGGAAAGAACTCTGGGGG + Intronic
1198334491 X:135653388-135653410 TTTTTGGGAGAGAACTTCTAAGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic