ID: 1144468324

View in Genome Browser
Species Human (GRCh38)
Location 17:15515097-15515119
Sequence GCCCATACCCACAGTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144468317_1144468324 8 Left 1144468317 17:15515066-15515088 CCAGAATACACAAGCCGGAGGTG 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG 0: 1
1: 0
2: 2
3: 14
4: 200
1144468321_1144468324 -6 Left 1144468321 17:15515080-15515102 CCGGAGGTGGCTAGGGTGCCCAT 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG 0: 1
1: 0
2: 2
3: 14
4: 200
1144468314_1144468324 23 Left 1144468314 17:15515051-15515073 CCGGAAACACAGCTGCCAGAATA 0: 1
1: 0
2: 3
3: 19
4: 205
Right 1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG 0: 1
1: 0
2: 2
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144468324 Original CRISPR GCCCATACCCACAGTGGGCA TGG Intronic
902821369 1:18945328-18945350 GCCTATTGCCACAGTGGGCCAGG + Intronic
903666389 1:25010067-25010089 GTCCCCACCCACACTGGGCAGGG + Intergenic
904762883 1:32817973-32817995 GCCCCCACCCCCACTGGGCAGGG - Exonic
905292749 1:36933988-36934010 GACCACACTTACAGTGGGCAGGG + Intronic
907522595 1:55033941-55033963 TCCCATAGCCCCAGAGGGCAAGG - Intergenic
913039331 1:115007552-115007574 GCCCATAAACAAAGTGGCCATGG - Intergenic
916787007 1:168093719-168093741 GACCAGACCCTCTGTGGGCAAGG - Intronic
919430583 1:197486862-197486884 CCCCATCCCCACAGTGGCCGTGG + Intergenic
919661720 1:200254231-200254253 GCCCAGAGCCACAGAGGGAAGGG + Intergenic
920651458 1:207840403-207840425 CCCGATGCCCACAGTGGGAAGGG - Intergenic
921165522 1:212504111-212504133 GCCCAGAGCCAGTGTGGGCAGGG - Intergenic
921203617 1:212829423-212829445 GTCCATCCCCACAGTGGTGATGG - Intergenic
922202582 1:223418662-223418684 GCCTGTGCCCCCAGTGGGCAGGG - Intergenic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
1064168238 10:13004780-13004802 GCCCATAAACAGAGTGGCCATGG - Intronic
1065304704 10:24357172-24357194 TCCTCTACCTACAGTGGGCAGGG - Intronic
1066068245 10:31778248-31778270 CACCATACCCTCAGTGTGCAGGG - Intergenic
1066126719 10:32348822-32348844 GCCCCTTCCCACAGTGGCCTGGG - Intronic
1066558139 10:36638735-36638757 GCCCATATCGACAAAGGGCATGG - Intergenic
1067333257 10:45341065-45341087 GCCCATAAACAAAGTGGCCATGG + Intergenic
1067451726 10:46385793-46385815 GCTCTTACCCACAGTGAGCATGG - Intronic
1067585512 10:47473962-47473984 GCTCTTACCCACAGTGAGCATGG + Exonic
1067794685 10:49312210-49312232 GCACATATTCACAGTGGGCATGG + Intronic
1067802442 10:49368369-49368391 GCACACACGCACAGTGTGCAAGG + Intronic
1069602223 10:69715307-69715329 GCCCTTACCCACAGCCTGCAAGG + Intergenic
1069992385 10:72323500-72323522 GCACCTACCCACATAGGGCAGGG + Intergenic
1070820012 10:79348979-79349001 ACCCACCCCCACAGTGGCCAAGG - Intronic
1071305863 10:84298401-84298423 GCCCAAACCCACAATGAGGAAGG - Intergenic
1072360581 10:94654990-94655012 GCCCATAAACAAAGTGGCCATGG + Intergenic
1072635359 10:97174325-97174347 GCCCCTAGGCTCAGTGGGCAGGG - Intronic
1072708001 10:97696028-97696050 GCCCATAAACAAAGTGGCCATGG + Intergenic
1073099024 10:100997531-100997553 GCGCGGACCCACAGCGGGCAGGG + Intronic
1073890067 10:108091023-108091045 GGCAGTACTCACAGTGGGCACGG + Intergenic
1074781079 10:116802789-116802811 GCCAAGCCCAACAGTGGGCAGGG - Intergenic
1075741115 10:124697167-124697189 GCCCACTCGCTCAGTGGGCACGG + Intronic
1076334521 10:129696667-129696689 ACCCATTCGCTCAGTGGGCAGGG + Intronic
1076399927 10:130175846-130175868 CCCCAGGCCCACTGTGGGCATGG + Intronic
1076399929 10:130175848-130175870 CACCATGCCCACAGTGGGCCTGG - Intronic
1077323278 11:1952007-1952029 ACCAAGACCCACAGGGGGCAGGG - Intronic
1077490803 11:2860111-2860133 GCTCATGCTCACACTGGGCATGG + Intergenic
1081381421 11:42420916-42420938 GACCATACCAACAGTTGGCAAGG + Intergenic
1083729948 11:64647511-64647533 GCCCCTCCCCAGAGAGGGCAGGG - Intronic
1084028276 11:66466523-66466545 GCCCTGACCGACAGTGGGGAGGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085019327 11:73195334-73195356 GCACATACCTACAGAGGCCAGGG - Intergenic
1086878286 11:92124376-92124398 GCTCATTCCCATAGTGGGAATGG - Intergenic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1202806266 11_KI270721v1_random:7202-7224 ACCAAGACCCACAGGGGGCAGGG - Intergenic
1093170252 12:15852315-15852337 ACCCATGCCCACAGAGAGCATGG + Intronic
1098543512 12:71686078-71686100 GCGCATGCCCACAGCGGGCGAGG + Exonic
1102535285 12:113576407-113576429 GCACAGACCCACAAGGGGCATGG - Intergenic
1104014874 12:124955231-124955253 GCCCACACCCACATTGGGGGAGG - Intronic
1104763528 12:131312438-131312460 GCCCAGCACCACGGTGGGCACGG + Intergenic
1104815974 12:131645639-131645661 GCCCAGCACCACGGTGGGCACGG - Intergenic
1105796287 13:23856664-23856686 GCCCAGACCAACAGATGGCAAGG - Intronic
1106046171 13:26144219-26144241 GCCCATAAACAAAGTGGCCATGG - Intronic
1108441327 13:50456267-50456289 GCCAAGAGCCACAGTGGACAAGG - Intronic
1108732408 13:53248516-53248538 GCAGCTACCCACAGTGGGCTAGG - Intergenic
1110404446 13:75134125-75134147 GCCCAAACCCAAAGTGGGCAAGG + Intergenic
1110871001 13:80452321-80452343 ACCCATACCCACAGTGGAGCCGG + Intergenic
1113472929 13:110559521-110559543 GCCCTTGCCCAGAGTTGGCAGGG - Intronic
1113485690 13:110650827-110650849 GCCCACATCCACTGTGGGCCGGG + Intronic
1113784880 13:112997202-112997224 GGCCAGACCCACAGTGGTCTTGG - Intronic
1117789816 14:59328568-59328590 GCCCATCCACACAGTGAGAAAGG - Intronic
1119383881 14:74245379-74245401 GCACATGCCCACAGTGGGGCTGG - Intronic
1121239782 14:92420785-92420807 GAGAATACCCACGGTGGGCATGG + Intronic
1122064233 14:99160371-99160393 GCCTTTACCAACAGCGGGCAAGG + Intergenic
1122159044 14:99769456-99769478 GGCCTCCCCCACAGTGGGCAGGG + Intronic
1122159379 14:99772267-99772289 GCCCAAACACACAGTTTGCAAGG - Intronic
1202849306 14_GL000225v1_random:7049-7071 GACCATGCCCCCAGTAGGCAGGG + Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125274988 15:37979859-37979881 CCACTTACCCTCAGTGGGCAGGG - Intergenic
1126779212 15:52124313-52124335 GCCCACAGCCACAGAGGGAATGG - Intronic
1131060983 15:89404615-89404637 GCACATACCAAGAGTGGGGAGGG - Intergenic
1131223915 15:90608133-90608155 CCCCTTACTCACAGTGGCCAGGG - Intronic
1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG + Intronic
1134521350 16:14920448-14920470 GGCGAGACCCACAGTGGGCAGGG - Intronic
1134522527 16:14925179-14925201 GCACACACTCACAGAGGGCAGGG - Intronic
1134709025 16:16319099-16319121 GGCGAGACCCACAGTGGGCAGGG - Intergenic
1134716234 16:16359133-16359155 GGGGAGACCCACAGTGGGCAGGG - Intergenic
1134950580 16:18349546-18349568 GGCGAGACCCACAGTGGGCAGGG + Intergenic
1134958518 16:18393026-18393048 GGGGAGACCCACAGTGGGCAGGG + Intergenic
1139366866 16:66438942-66438964 GGCATTACCCACAGTGAGCAGGG - Intronic
1141882563 16:86869508-86869530 GCCTTCTCCCACAGTGGGCAGGG + Intergenic
1142010692 16:87712336-87712358 GCCCATGCCCAGTGTGGGCGTGG + Intronic
1142586650 17:978851-978873 GCGGATTCCCACAGTGGGGAGGG - Intronic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1144468326 17:15515099-15515121 GGCCATGCCCACTGTGGGTATGG - Intronic
1145323975 17:21783280-21783302 GCCCCTACGGACAGAGGGCATGG + Intergenic
1147689861 17:42308443-42308465 GCCAAAACCCACAGGGGACATGG - Intronic
1148776270 17:50097173-50097195 GCCTTTAACCACAGTGGACAGGG - Intronic
1152142155 17:78542972-78542994 GGCCATACCCACATTGTGCTGGG + Intronic
1158537704 18:58322910-58322932 ACCCATACCCACAGCATGCAGGG - Intronic
1160513507 18:79465852-79465874 GCCCAGACCCACAGTGCTCTGGG + Intronic
1161604397 19:5206679-5206701 GCCTGGACCCCCAGTGGGCAGGG - Exonic
1161687016 19:5707914-5707936 GCCCATAGCTACAGGGGACAGGG - Intronic
1165855783 19:38878738-38878760 GCCCACACCCACACTGGGGTAGG + Exonic
1168145926 19:54420257-54420279 CCCCGGACCCACAGCGGGCAAGG + Intronic
1168720268 19:58550881-58550903 CCCCATACCCAGAAAGGGCAAGG - Intergenic
927150237 2:20191406-20191428 GCTCACACCCACAGTGCTCAGGG - Intergenic
930026933 2:47034711-47034733 TCCCCTCTCCACAGTGGGCAAGG + Intronic
932323638 2:70839692-70839714 GCCTATAGCCTCAGTGGGAAGGG + Intergenic
932870588 2:75394265-75394287 GCCCATGACCAAAGTGGCCATGG - Intergenic
933629431 2:84639131-84639153 CCCCATACCCACTGTGGGCATGG + Intronic
933629433 2:84639133-84639155 CACCATGCCCACAGTGGGTATGG - Intronic
934646601 2:96062734-96062756 GCCCAGATCCACAGTGGCCTGGG - Intergenic
934840002 2:97618816-97618838 GCCCAGATCCACAGTGGCCTGGG - Intergenic
943383958 2:187180272-187180294 GCCCATGAACAAAGTGGGCATGG - Intergenic
944280055 2:197885476-197885498 GCTGATGCCCACAGTGGGGAGGG + Intronic
945137529 2:206644292-206644314 GCACATTCCCACAATGAGCAGGG - Intergenic
947331270 2:229032097-229032119 GCCCAAATACACAGGGGGCATGG - Intronic
1169210738 20:3764990-3765012 GGTCCTACCCTCAGTGGGCATGG - Intronic
1171234151 20:23510713-23510735 GCCCATGCTCACAGTGAGCCTGG + Intergenic
1172096590 20:32463490-32463512 GCCCTTTGCCACAGTGGGGAGGG - Intronic
1172202739 20:33138387-33138409 GCCCACACCCCCAGTGAGAATGG + Intergenic
1172813879 20:37671082-37671104 GTGAACACCCACAGTGGGCAAGG - Intergenic
1174709212 20:52687053-52687075 CCCCAGACCCTCAGAGGGCATGG - Intergenic
1175630718 20:60534305-60534327 GCCCATACCCAGATTTGTCATGG + Intergenic
1178005930 21:28219614-28219636 GCCCATAAACAAAGTGGCCATGG - Intergenic
1180764202 22:18234239-18234261 GGCCCTACCCACATTGGGGATGG - Intergenic
1180771440 22:18390302-18390324 GGCCCTACCCACATTGGGGATGG + Intergenic
1180802822 22:18639917-18639939 GGCCCTACCCACATTGGGGATGG + Intergenic
1180854064 22:19035473-19035495 GGCCCTACCCACATTGGGGATGG + Intergenic
1181218896 22:21355344-21355366 GGCCCTACCCACATTGGGGATGG - Intergenic
1181573226 22:23779071-23779093 GCCCAGCCACACAGTGGGCTGGG + Intronic
1182334079 22:29571451-29571473 GCCCTTAACCACAGTGCTCATGG - Intronic
1183280764 22:36930842-36930864 GACCATCCCCACAGCGGGCTAGG - Intronic
1183454719 22:37916191-37916213 GCCCATGCCCACACTCAGCACGG - Intronic
1183630850 22:39031803-39031825 GCCCTTGCCCAGAGTGTGCAGGG + Exonic
1183634366 22:39052183-39052205 GCCCTTGCCCAGAGTGTGCAGGG + Exonic
1183637049 22:39070502-39070524 GCCCTTGCCCAGAGTGTGCAGGG + Intronic
1184367825 22:44063729-44063751 GTCCACACTCACAGAGGGCATGG + Intronic
1184389098 22:44192722-44192744 GGCCACACCCCCGGTGGGCAGGG - Intronic
1184862352 22:47179996-47180018 GACCACACCCAGTGTGGGCAAGG - Intergenic
1185370762 22:50459877-50459899 GCCCAGGCCCACAGCGGGCAGGG + Intronic
1203233279 22_KI270731v1_random:131293-131315 GGCCCTACCCACATTGGGGATGG + Intergenic
949880878 3:8659658-8659680 ACCCAAACCCTCAATGGGCATGG + Intronic
950113865 3:10438100-10438122 GCCCATACCCACTGTGTGCTGGG + Intronic
950195533 3:11006643-11006665 CCCCATGCCCACAGTGGAGAGGG + Intronic
950447999 3:13049120-13049142 GCCAGAACCCACACTGGGCATGG + Intronic
950788387 3:15453902-15453924 GACCATCTCCACAGTAGGCACGG + Exonic
953979216 3:47405366-47405388 GCCCAAAACCACAGTGGGGAGGG - Intronic
955522509 3:59788501-59788523 GCCCCTAACCACAGGAGGCAGGG - Intronic
956654687 3:71537364-71537386 GCCAATACCCACACTGAGCTGGG - Intronic
958934418 3:100241430-100241452 GCCCATAAACAAAGTGGCCATGG + Intergenic
960005977 3:112781654-112781676 GCTCATGACCACAGTGGGTAAGG - Intronic
961364600 3:126391185-126391207 GTGCAGACCCACAGTGGGCCTGG - Intergenic
961458497 3:127035975-127035997 GCCCACCCCCTCAGTGGGCTGGG - Exonic
961826722 3:129603124-129603146 GCCTGTGCCCACAGCGGGCACGG + Intronic
965683760 3:171279541-171279563 GCCAATAGCCAGAGTTGGCAAGG - Intronic
968595580 4:1480792-1480814 GCCCATACCCTCCATGGGTAGGG + Intergenic
968889537 4:3360849-3360871 GCTCAAATGCACAGTGGGCAAGG + Intronic
969251850 4:5973478-5973500 GCCCATGCCCTGGGTGGGCATGG - Intronic
970471165 4:16380708-16380730 GCACAGAACCACAATGGGCAGGG - Intergenic
971100904 4:23465602-23465624 GCCCATAAGCAAAGTGGCCATGG - Intergenic
971687276 4:29786269-29786291 GCCCATGAACACAGTGGCCATGG - Intergenic
972410424 4:38787970-38787992 GACCATTCCCAGAGTGAGCAGGG - Intergenic
976028629 4:80723091-80723113 GACCATACCAACTGTTGGCAAGG + Intronic
980798047 4:137711136-137711158 TCCCAGACCCACAGATGGCATGG + Intergenic
981174787 4:141668384-141668406 GCCAAAACCCACAGGGAGCATGG - Intronic
983782886 4:171695167-171695189 TCACATACCCACAGTGTACACGG + Intergenic
985168402 4:187122561-187122583 CCCGATACACACAATGGGCATGG - Intergenic
985780679 5:1869350-1869372 TCCCTCACCCGCAGTGGGCAGGG - Intergenic
985820757 5:2158495-2158517 GCCCTGACCCACAGTGCCCAGGG - Intergenic
986747741 5:10759367-10759389 GCTCCTCCCCACAGTGGACAGGG + Intronic
990005373 5:50938938-50938960 TCCCACACCCACAGTGGCTATGG + Intergenic
992427669 5:76674776-76674798 GCCCAGAGCTAGAGTGGGCATGG + Intronic
993901881 5:93589502-93589524 AACCCTACTCACAGTGGGCAGGG - Intronic
995373618 5:111449467-111449489 GACCATCACCACAGAGGGCAAGG + Intronic
999274338 5:150319089-150319111 GCCCCTCCCCAAAGTAGGCAGGG + Intronic
1004732135 6:18368246-18368268 GCACATAACCACAGTGTGCGAGG + Intergenic
1005840549 6:29742313-29742335 GGCGGAACCCACAGTGGGCAGGG - Intergenic
1007094594 6:39205496-39205518 GGCCATAGCCACCCTGGGCAGGG - Intronic
1007916055 6:45562657-45562679 GCCCATAGCCACTGTGGGTTAGG + Intronic
1010107837 6:72189752-72189774 GCCCATGAACACAGTGGCCATGG - Intronic
1010792074 6:80075981-80076003 GCCACTGGCCACAGTGGGCAGGG + Intergenic
1017403525 6:154091906-154091928 ATCCATGACCACAGTGGGCAAGG - Intronic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1019327530 7:445695-445717 GCCCAAGCCCGCAGTGGGGAAGG - Intergenic
1020112513 7:5455556-5455578 GCCCATTCCCACCGAGGGGATGG - Intronic
1021123780 7:16826626-16826648 GGCAGTACTCACAGTGGGCATGG + Intronic
1021849197 7:24791148-24791170 GACCACTCCCACAGTGGTCAAGG - Intergenic
1022544462 7:31173262-31173284 GCCAGGACCCACAGAGGGCAGGG + Intergenic
1023529517 7:41137755-41137777 ATCCACACCCCCAGTGGGCATGG - Intergenic
1025951920 7:66152128-66152150 GACCATGAGCACAGTGGGCAGGG + Intronic
1026390040 7:69891623-69891645 GACCCTACCGAGAGTGGGCAAGG - Intronic
1028197127 7:87920234-87920256 CCCCATCCCCACAGTGGCCATGG + Intergenic
1029156591 7:98521748-98521770 CCACATTCCCACAGTGGGCAGGG - Intergenic
1029185535 7:98735803-98735825 CCCAAAAACCACAGTGGGCAGGG + Intergenic
1029648724 7:101875678-101875700 GCCCCTCCCCACAGTGCCCACGG + Intronic
1032522769 7:132558953-132558975 GGCCTTACCCGCAGTGGACAGGG + Intronic
1032706750 7:134426602-134426624 GCTCATGCCCACAGTGCGCTGGG + Intergenic
1037817832 8:22121053-22121075 GCCCTCACTCACACTGGGCAGGG + Exonic
1043362281 8:79488672-79488694 GCACATACACACAGTGGTGAGGG + Intergenic
1044684141 8:94811102-94811124 GCCCTTCCCCACAGTGAGCCTGG + Intergenic
1044967068 8:97584110-97584132 TCCCATCCCCACAGAGGCCAGGG - Intergenic
1047771948 8:128036943-128036965 GCCCAAACCCATGGTGGGCCTGG - Intergenic
1049488186 8:142877215-142877237 GCCCATTCCTACAGAGGCCAGGG + Exonic
1049493075 8:142915238-142915260 GCCCATTCCTACAGAGGCCAGGG + Exonic
1049691983 8:143965517-143965539 CCACAGACCCACAGTGGGTAGGG - Intronic
1049719976 8:144111260-144111282 GCCCCCACCCAGAGTGGGAAAGG - Intronic
1049828446 8:144685226-144685248 ACTCATACCCACCGTGGACAGGG + Intergenic
1051959600 9:22742558-22742580 CCCCATAACCACAGTTTGCAGGG + Intergenic
1053164080 9:35832492-35832514 AGCCATCCCCACAGTGGCCAGGG - Intronic
1056507651 9:87272325-87272347 ACCGATACCCACAGTCAGCAAGG + Intergenic
1061222296 9:129259154-129259176 GCCCAGCCCAGCAGTGGGCACGG - Intergenic
1061808377 9:133148882-133148904 GCCCACACCCACCGGGGGGAGGG - Intronic
1061975586 9:134066908-134066930 GCCGAGACCCACCGGGGGCAGGG - Intronic
1062179047 9:135180808-135180830 GTCCAGCCCCACAGTGGGAAGGG - Intergenic
1062347648 9:136122775-136122797 GCCAAAACCCACGGTGGCCACGG - Intergenic
1193053604 X:77126584-77126606 GCCCATAAACAAAGTGGCCATGG + Intergenic
1194454003 X:94080024-94080046 GCCCATACATAAAGTGGCCATGG - Intergenic
1198678359 X:139155221-139155243 CCCCATACCCTCAGGGTGCATGG + Intronic
1199532201 X:148862352-148862374 ACACATTCCCACAGAGGGCAGGG - Intronic
1199673344 X:150164656-150164678 GCCCACATCTACAGTGTGCATGG - Intergenic