ID: 1144469540

View in Genome Browser
Species Human (GRCh38)
Location 17:15525217-15525239
Sequence TGCCATTAGGTGCCCGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144469537_1144469540 -4 Left 1144469537 17:15525198-15525220 CCAATAAATGTTTATTGAGTGCC 0: 2
1: 10
2: 41
3: 220
4: 875
Right 1144469540 17:15525217-15525239 TGCCATTAGGTGCCCGGCACTGG 0: 2
1: 0
2: 0
3: 8
4: 97
1144469536_1144469540 -3 Left 1144469536 17:15525197-15525219 CCCAATAAATGTTTATTGAGTGC 0: 2
1: 4
2: 33
3: 149
4: 767
Right 1144469540 17:15525217-15525239 TGCCATTAGGTGCCCGGCACTGG 0: 2
1: 0
2: 0
3: 8
4: 97
1144469535_1144469540 24 Left 1144469535 17:15525170-15525192 CCTACACTGTTAAAAGGCGGGCA 0: 2
1: 0
2: 1
3: 3
4: 73
Right 1144469540 17:15525217-15525239 TGCCATTAGGTGCCCGGCACTGG 0: 2
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144469540 Original CRISPR TGCCATTAGGTGCCCGGCAC TGG Intronic
901604895 1:10451456-10451478 TCCTATGAGGGGCCCGGCACTGG - Exonic
902815193 1:18912628-18912650 ACCCATTAGGTGCTGGGCACTGG + Intronic
902989159 1:20174099-20174121 TGCCCTTATGTGCCAAGCACTGG - Intronic
904664805 1:32111831-32111853 TGCCACTAGGTGCCCTGTAGGGG + Intronic
904961369 1:34335724-34335746 TGGCATGAGGTGCCTGGCATCGG + Intergenic
912452512 1:109776077-109776099 ACCTATTAGGTGCCAGGCACTGG - Intergenic
915330331 1:155107750-155107772 TGCCACTGTGTGCCAGGCACTGG + Intergenic
918069170 1:181122428-181122450 TGCCAGCTGGTGCCCAGCACAGG + Intergenic
920349506 1:205328595-205328617 TGCCATTGGGAGCCAGGCACGGG - Intergenic
1065203271 10:23334503-23334525 TGCCATGGGGTGCCCCGCATGGG - Intronic
1066123333 10:32313324-32313346 AACCATTATGTGCCTGGCACTGG + Intronic
1066988394 10:42488692-42488714 TGCCATGAGGTGCCTGTCCCAGG + Intergenic
1069908299 10:71745115-71745137 GGCCACTATGTGCCAGGCACTGG + Intronic
1074185913 10:111099212-111099234 TGCCTTTGGGTGCCTGGCTCAGG + Intergenic
1090915095 11:131156015-131156037 TGCCATCAGGTGGCCGGAGCCGG - Intergenic
1094204252 12:27823984-27824006 TCACCTTATGTGCCCGGCACAGG + Intergenic
1095185809 12:39199246-39199268 TGCCATGAGGGGCCCGTCCCAGG - Intergenic
1102880626 12:116482098-116482120 TCCCATAAGGTGCCCAGCATAGG - Intergenic
1104720683 12:131043608-131043630 GGCCATGGGGTGCCCAGCACTGG + Intronic
1106475048 13:30091214-30091236 TGCCACTAGGATCCCTGCACAGG + Intergenic
1112202125 13:97286941-97286963 AGCCAGTAGCTGCCAGGCACAGG - Intronic
1113552135 13:111200793-111200815 TGCCAGAAGGGGCCCTGCACTGG - Intronic
1115334590 14:32232131-32232153 TAGCATTAAGTGCCAGGCACTGG - Intergenic
1119654419 14:76406956-76406978 AGCCTTTAGGTGCCAGACACTGG - Intronic
1122306112 14:100767873-100767895 TGGCATTGGGTGCCCTGCAAAGG + Intergenic
1202837752 14_GL000009v2_random:90987-91009 TGTCATTGTGTGCCCGGCAGTGG + Intergenic
1124128648 15:26964886-26964908 TGATATTAGGGGGCCGGCACAGG + Intergenic
1130872305 15:87981091-87981113 TACGACTAGGTGCCCAGCACGGG - Intronic
1132481509 16:168560-168582 TGCCAGGAGGTGCCTGGCACAGG - Intergenic
1133044561 16:3080321-3080343 TGCCATGAGGTGCCCGTCCCGGG - Intronic
1140359061 16:74329500-74329522 TGCTAATGGGTCCCCGGCACTGG + Intergenic
1141789645 16:86225866-86225888 TCCCATCAGGTGCCAGGCACTGG + Intergenic
1144469540 17:15525217-15525239 TGCCATTAGGTGCCCGGCACTGG + Intronic
1144926815 17:18818458-18818480 TGCCATTAGGTGCCCGGCACTGG - Intergenic
1144967797 17:19089024-19089046 TGCCATAGGGAGCCCGGCCCGGG + Intergenic
1144980119 17:19163039-19163061 TGCCATAGGGAGCCCGGCCCGGG - Intergenic
1144988103 17:19215193-19215215 TGCCATAGGGAGCCCGGCCCGGG + Intergenic
1150486371 17:65546504-65546526 TGCCATTGGGTGCCAGGCATGGG - Intronic
1151654012 17:75487102-75487124 TGCCACCATGTGCCAGGCACTGG + Intronic
1153905553 18:9658422-9658444 TGCCTTTAGTTGCCCGGGCCTGG + Intergenic
1154406453 18:14096129-14096151 TGCCATGATGGGCCCAGCACTGG + Intronic
1158130935 18:54151965-54151987 AGCTATTACGTGCCAGGCACTGG + Exonic
1158225724 18:55199007-55199029 TGCCAAAATGTGCACGGCACTGG - Intergenic
1158867992 18:61656674-61656696 TCGCATTATGTGCCAGGCACTGG - Intergenic
1162603346 19:11687590-11687612 TGCCATTAGGATCCCTGCATGGG + Intergenic
1163688379 19:18725183-18725205 TGCCATGAGGGGCCAGGCAGGGG - Intronic
1165258054 19:34591963-34591985 TTCCACTGGGTGCCCGGCTCTGG + Intergenic
1166199428 19:41226808-41226830 AGCCACTCGGTGCCCGGCCCTGG - Intronic
1166348096 19:42179309-42179331 AGCCATAATGTGCCTGGCACAGG - Intronic
934922945 2:98360249-98360271 GGCCACTAGGTGCCAGCCACAGG - Intronic
935649885 2:105373151-105373173 TGCCCTTGCGTGCCAGGCACTGG - Intronic
936075514 2:109399078-109399100 TGCCCTTTGCTGCCTGGCACTGG + Intronic
937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG + Exonic
943062421 2:183052652-183052674 TGCCATGAGGGGCCCGTCCCAGG - Intergenic
945034812 2:205695818-205695840 TGACATTAGGTTCCCAGCATGGG + Intronic
1172943777 20:38672842-38672864 TGCTACTTGGTGCCCAGCACTGG - Intergenic
1176246148 20:64098123-64098145 TGCCATCATGGGCTCGGCACAGG + Exonic
1176626482 21:9095918-9095940 TGTCATTGTGTGCCCGGCAGTGG + Intergenic
1176647111 21:9362120-9362142 TGTCATTGTGTGCCCGGCAGTGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1182102865 22:27670157-27670179 TGCCCCTCGGTGCCTGGCACAGG - Intergenic
1184329391 22:43817162-43817184 TTCCCTTAGGTGCCCTGCAGTGG + Intergenic
1184959393 22:47918013-47918035 TGCCATTACATGCCAGGCACTGG + Intergenic
954832525 3:53434641-53434663 TGCCATTGTGTGCCAGGCAATGG - Intergenic
961326249 3:126111105-126111127 TGCCACGATGGGCCCGGCACAGG - Intronic
961819377 3:129567441-129567463 TGCCTTGAGGTGGCTGGCACAGG + Intronic
967201975 3:187079781-187079803 AGCCATCATGTGCCTGGCACTGG + Intergenic
969543827 4:7811083-7811105 GGCCGTTATGTGCCCAGCACTGG + Intronic
969597971 4:8159500-8159522 TGACATCAGGCGCCCAGCACAGG + Intergenic
969652690 4:8477356-8477378 TGCCAGGAGGTGCCTGGCCCTGG + Intronic
969841898 4:9888949-9888971 TGCCCCTGGGTGCCAGGCACTGG + Intronic
970246109 4:14065635-14065657 TTCCATTATGTGCCAGGCATTGG + Intergenic
970538726 4:17056129-17056151 TGCCCTTAGGCTCCCTGCACTGG - Intergenic
975214772 4:71740547-71740569 TGCCTTTAGCTGCCAGGAACTGG - Intergenic
976709395 4:88053066-88053088 TGCCATTCGGTCACCAGCACAGG + Intronic
977016673 4:91700040-91700062 TGCCATGAGGGGCCCGTCTCAGG - Intergenic
991100138 5:62783141-62783163 TGACATTAGCTGTCTGGCACTGG - Intergenic
999092616 5:148950512-148950534 TCCCATAAGGTGCCAGGCACAGG - Intronic
1002966966 6:1976398-1976420 TCCCGTTATGTGCCAGGCACTGG - Intronic
1007315686 6:40986781-40986803 GGCCACTAGGTCCCGGGCACAGG + Intergenic
1016580556 6:145625035-145625057 TGCCATTAGCTGCTTGTCACTGG - Intronic
1019312534 7:369700-369722 TGCCATAAAGTGCCCGTCAGGGG - Intergenic
1022012708 7:26322818-26322840 TGCGATTATGTGCCGAGCACTGG + Intronic
1022126557 7:27363236-27363258 TCCCATTATGTGCTCAGCACAGG - Intergenic
1023831216 7:44039928-44039950 TGCACCTATGTGCCCGGCACCGG - Intergenic
1023878432 7:44305551-44305573 TCCCCTGAGGTGCCCTGCACTGG + Intronic
1029741545 7:102494234-102494256 TGCACCTATGTGCCCGGCACCGG - Intronic
1029759536 7:102593403-102593425 TGCACCTATGTGCCCGGCACCGG - Intronic
1029776903 7:102689313-102689335 TGCACCTATGTGCCCGGCACCGG - Intergenic
1031844367 7:126786629-126786651 TGCCATGAGGTGGCCTGTACAGG - Intronic
1032487679 7:132300305-132300327 TGCCTTTAGGTGGCCACCACCGG - Intronic
1036724223 8:11205027-11205049 TGCCAGTAGCTGCCTGGCCCAGG - Intergenic
1036971633 8:13361871-13361893 TGACATTAGGTGCTGGGCACTGG + Intronic
1040080446 8:43278999-43279021 TGGCACTAGGTGCCAGGTACTGG - Intergenic
1043718411 8:83512188-83512210 AGCCATTGCGTGCCCAGCACAGG + Intergenic
1049003364 8:139839828-139839850 TGCCAGCCGGTGCCAGGCACTGG + Intronic
1054922249 9:70554246-70554268 TGCCGTGAGGTGCCAGGCATGGG + Intronic
1055651244 9:78409406-78409428 TGCGATTTTGTGCCAGGCACTGG + Intergenic
1061492578 9:130954214-130954236 TGCCTGCAGGTGCCCAGCACTGG - Intergenic
1062628554 9:137453713-137453735 AGACAGTAGGTGCCCCGCACAGG - Exonic
1203749654 Un_GL000218v1:66332-66354 TGTCATTGTGTGCCCGGCAGTGG + Intergenic
1203708415 Un_KI270742v1:72829-72851 TGTCATTGTGTGCCCGGCAGTGG + Intergenic
1189448442 X:41103803-41103825 TGGCATTAGGTGACTGGAACTGG + Intronic
1192504882 X:71675745-71675767 TCCCATTAGGGGCCGGGCAGAGG - Intergenic
1192547848 X:72028466-72028488 TGCCTATTGGTGCCCGTCACTGG + Intergenic
1194800138 X:98263041-98263063 TCCCATTATGTTCCAGGCACTGG + Intergenic
1198552009 X:137755340-137755362 TGCTATTATGTGTCAGGCACTGG + Intergenic