ID: 1144469852

View in Genome Browser
Species Human (GRCh38)
Location 17:15528927-15528949
Sequence GATGATTAACTAGGAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144469852 Original CRISPR GATGATTAACTAGGAAAAAG AGG (reversed) Intronic
904425979 1:30423400-30423422 GGTAATTTACAAGGAAAAAGAGG - Intergenic
904554454 1:31349631-31349653 TATTATTACCTAGAAAAAAGTGG - Intronic
904722693 1:32522493-32522515 AATTATTAACTAGTAAAAGGTGG - Intronic
906220996 1:44079268-44079290 AATGATTAACTAGTCACAAGGGG - Intergenic
906648414 1:47492657-47492679 GATGATAAACTAGGCAATGGAGG - Intergenic
906820707 1:48927199-48927221 GATAATTTATAAGGAAAAAGAGG + Intronic
907029791 1:51159501-51159523 GATGAATAAATAAGAAAATGTGG - Intergenic
909912341 1:81276608-81276630 GGGGATTAACTAGGCCAAAGAGG - Intergenic
910981670 1:92964555-92964577 GATGATTAAGGAGGGAAGAGTGG + Intergenic
911407178 1:97456788-97456810 GATAATTATCTAGGAAAATGGGG + Intronic
911520232 1:98920746-98920768 GATTATTAACTAGTAAAATGAGG + Intronic
912468290 1:109889130-109889152 GATGTTTTCCTAGGAAGAAGAGG + Intergenic
912663221 1:111553780-111553802 GTTGACTAAATAGGAAAAAAGGG - Intronic
912835872 1:112995948-112995970 GGTGAAGAACTAGGAAACAGTGG - Intergenic
913692766 1:121295111-121295133 GAAGATACTCTAGGAAAAAGGGG + Intronic
914144793 1:144984977-144984999 GAAGATACTCTAGGAAAAAGGGG - Intronic
916984828 1:170179994-170180016 GATGAGTAAGTATGAAAGAGAGG + Intergenic
917397080 1:174604734-174604756 GATTATTACCTAAGAAAAATGGG + Intronic
917927536 1:179801543-179801565 GAGGATTACCTGGGAAAATGGGG - Intronic
918963937 1:191316603-191316625 GATGTTTAAGTACGAAAAAGAGG - Intergenic
918999175 1:191806544-191806566 TAAAATTAACTAGGAAAAACTGG - Intergenic
920384172 1:205556314-205556336 AAAGATTAATTAGGAAAAAGTGG + Intergenic
920480085 1:206313476-206313498 GAAGATACTCTAGGAAAAAGGGG + Intronic
921164686 1:212498285-212498307 GCTGATTGAGAAGGAAAAAGAGG + Intergenic
921414700 1:214872168-214872190 GATGATTAATTACTAAAATGAGG + Intergenic
921570076 1:216767198-216767220 TATGAGTAACTAGGAAAGAAAGG - Intronic
921576558 1:216841891-216841913 GATGATTTACAAAAAAAAAGAGG + Intronic
921910303 1:220541458-220541480 GAAGATCAACAAGGAAACAGAGG - Intronic
923523328 1:234752919-234752941 GATGATCAGGTAGGAAAGAGGGG + Intergenic
923788462 1:237091113-237091135 GATGGTTAACTTTGAAAATGTGG + Intronic
924367666 1:243312957-243312979 GATCATTAAGCAAGAAAAAGAGG - Intronic
924478128 1:244399581-244399603 GAAGATTAATAAGGAAATAGAGG - Intergenic
1065075019 10:22069455-22069477 GATGACCAACAAGGAAAGAGAGG - Intergenic
1067273569 10:44814199-44814221 GAAGAATAACTAGGAAGATGAGG - Intergenic
1069317542 10:67125879-67125901 GATGCTCAACTAGAAAAAACTGG + Intronic
1069638655 10:69941105-69941127 CATGATTCACTGGGAAAATGAGG - Intronic
1070038128 10:72748009-72748031 GAAGATTAAGTATGAAAAAAAGG - Intronic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1070360608 10:75684901-75684923 GATGACAAACTGGGAGAAAGTGG - Intronic
1071179712 10:82968826-82968848 GATGATTTATGAAGAAAAAGAGG + Intronic
1071420362 10:85490746-85490768 GAAGATCAACAAGGAAACAGAGG + Intergenic
1072553864 10:96499436-96499458 AATTATCAACTAGGAAAAGGGGG - Intronic
1073526795 10:104190440-104190462 GATGCTTAATAAGGCAAAAGAGG - Intronic
1075150892 10:119929985-119930007 GAGAATTTACTAGGATAAAGAGG - Intronic
1075644005 10:124085864-124085886 GATGATGAAGTAGGCAAATGTGG + Intronic
1077723877 11:4654084-4654106 GAAAATTAAATAGGAAAAACAGG - Exonic
1079717207 11:23763552-23763574 AAAAATTAACTAGGAAAAATAGG - Intergenic
1079764384 11:24373054-24373076 CATAATTAACTAGGAGACAGTGG - Intergenic
1080094293 11:28386662-28386684 GATGCTTAATAAGGAAATAGAGG + Intergenic
1080354220 11:31422993-31423015 GGTGATTAACTTGGGAAAATTGG - Intronic
1081374478 11:42342506-42342528 GATCATTTAGTAGGAACAAGGGG - Intergenic
1082173214 11:49031222-49031244 GATGAATGACTATGAAAGAGTGG - Intronic
1082729738 11:56780965-56780987 GATGATTTATAAAGAAAAAGAGG + Intergenic
1083129679 11:60613438-60613460 GTTGATTAGCTAGGAGGAAGGGG - Intergenic
1084480672 11:69418099-69418121 GAAGACTTAGTAGGAAAAAGGGG + Intergenic
1084786695 11:71446117-71446139 GATGAATGGCTAGGAAAGAGAGG + Intronic
1085543259 11:77292608-77292630 GATAATTAAATAGAAAAAATAGG + Intronic
1086371679 11:86161737-86161759 GATGATTAAATGAGAAAAAAAGG + Intergenic
1088792473 11:113238059-113238081 GATTTTTAACTACAAAAAAGAGG + Intronic
1090285142 11:125493872-125493894 TATGATTAACCAGCAACAAGAGG + Intronic
1090942243 11:131397034-131397056 CAGGAATAACTGGGAAAAAGTGG + Intronic
1092773802 12:11923401-11923423 GATTATTAAGTTGGTAAAAGGGG - Intergenic
1093292653 12:17347096-17347118 CATGATTAAATAGAAAAATGAGG + Intergenic
1094347485 12:29486674-29486696 GAAGATGAACTAGAAAAAATAGG + Intronic
1094688653 12:32746856-32746878 GATGAGGAACAATGAAAAAGAGG - Exonic
1094727165 12:33132172-33132194 GATGCATACCTAGGAAAAACTGG - Intergenic
1095163780 12:38947831-38947853 GATGAATAAATAAAAAAAAGTGG + Intergenic
1095851655 12:46815379-46815401 GTTGAATAACGAGCAAAAAGTGG - Intronic
1099516545 12:83603488-83603510 GATTATTAACTGGGCAAAAATGG + Intergenic
1100183841 12:92115419-92115441 TATCATTAAGCAGGAAAAAGAGG + Intronic
1100726138 12:97410840-97410862 GGTAATTAACCAGGAAAAATGGG - Intergenic
1101265990 12:103088330-103088352 GATGACTAAATAAGAAATAGGGG + Intergenic
1103976095 12:124703714-124703736 GATGATTAAGATGGAAAAAGGGG + Intergenic
1104552243 12:129767834-129767856 GGTAATTCACAAGGAAAAAGAGG + Intronic
1106939090 13:34756708-34756730 GAAGATCAACAAGGAAATAGAGG + Intergenic
1107072535 13:36286631-36286653 GATGATGAAGTTGGAAAAAAGGG - Intronic
1107183046 13:37484668-37484690 GATAATTTATAAGGAAAAAGAGG + Intergenic
1107905758 13:45059748-45059770 TTTGATTAACTACGAAAGAGAGG - Intergenic
1108270480 13:48755042-48755064 GATAATTTATAAGGAAAAAGAGG - Intergenic
1108270745 13:48756969-48756991 GATAATTTACAACGAAAAAGAGG - Intergenic
1109085671 13:57968522-57968544 GGTAATTTACTAAGAAAAAGAGG + Intergenic
1109489850 13:63083085-63083107 GAAGATTAACAAGGAAATAGAGG + Intergenic
1110179708 13:72601085-72601107 GATGATAAAATAGGGAAATGAGG - Intergenic
1110342711 13:74412007-74412029 GATAATTTATTAAGAAAAAGAGG - Intergenic
1110592040 13:77274672-77274694 GATGATGAGATAGGGAAAAGTGG - Intronic
1110947833 13:81445476-81445498 GATAATTAAATAGCACAAAGGGG + Intergenic
1111191653 13:84816005-84816027 GATGATTAATTAACAAAAAAGGG - Intergenic
1111484586 13:88879913-88879935 CATGATGAATAAGGAAAAAGAGG - Intergenic
1112190426 13:97172009-97172031 GATAATTTATAAGGAAAAAGAGG - Intergenic
1112421820 13:99258878-99258900 AATGTTTAAATAGTAAAAAGTGG - Intronic
1113084635 13:106555535-106555557 GATGAATTACTAGAAAAATGAGG - Intronic
1113529223 13:111008230-111008252 CATTATTAACTGGGAAAAAATGG + Intergenic
1114286314 14:21247234-21247256 GATTATGAACTAGGTAGAAGAGG - Intronic
1114829738 14:26126296-26126318 GATTACTAACTATGAGAAAGTGG - Intergenic
1115211955 14:30976301-30976323 GATAATTATCCAGGATAAAGAGG + Intronic
1115605498 14:34997779-34997801 TATGAGGAACTAGGAAAAAAAGG - Intronic
1115662434 14:35510589-35510611 GATAATTAAAAAGGAAAAAGTGG - Intergenic
1115892182 14:38043539-38043561 GATGTATAATTAAGAAAAAGAGG - Intergenic
1115918542 14:38344509-38344531 AATGGAAAACTAGGAAAAAGTGG + Intergenic
1118468691 14:66054990-66055012 GGTAATTTACAAGGAAAAAGAGG - Intergenic
1118990270 14:70791412-70791434 GGTGATGAAATAGGAAGAAGAGG + Intronic
1119186681 14:72648014-72648036 GTTGAGTAAGTAGGAAAAAGGGG - Intronic
1120313801 14:82865979-82866001 TATGAATAATTAGGAAACAGAGG - Intergenic
1121429538 14:93877274-93877296 GATAATTTACAAAGAAAAAGAGG + Intergenic
1122862522 14:104588908-104588930 GAGGGCTAACTAGGAAAAGGGGG + Exonic
1126361599 15:47852148-47852170 GAGGAAGCACTAGGAAAAAGTGG + Intergenic
1126378763 15:48024037-48024059 GATAATAATCTAGGAAAGAGAGG + Intergenic
1127049920 15:55070864-55070886 GAATATTAACAAGGATAAAGAGG + Intergenic
1127544538 15:59979072-59979094 GATAATTAACAAGCAAAAATAGG + Intergenic
1127544816 15:59982069-59982091 GATGATTAACTAGTATACATGGG + Intergenic
1129651694 15:77495771-77495793 GATGAAAAACTAGGAATAAGGGG - Intergenic
1131711811 15:95063774-95063796 GATGATTCACTATGATCAAGTGG + Intergenic
1131918509 15:97296857-97296879 AATCATTCACTAGGACAAAGTGG - Intergenic
1132012392 15:98287481-98287503 GATAATTTACAAAGAAAAAGAGG - Intergenic
1135187501 16:20327938-20327960 GATGATTAGCTAGGAACACAAGG - Intergenic
1135869948 16:26140454-26140476 GAAGATTAAGAAGGAAGAAGAGG + Intergenic
1136074836 16:27809894-27809916 GATGTGCAACTAGGAATAAGAGG - Intronic
1138464277 16:57176327-57176349 AATTATTTACTAGGAAAAATGGG - Intronic
1140492729 16:75353132-75353154 GATGATTAAAAAGGACTAAGAGG + Intronic
1142935035 17:3322222-3322244 GATGAATAAAAATGAAAAAGGGG - Intergenic
1143980213 17:10862670-10862692 GATTATTAATGAGGAAAAAGAGG + Intergenic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1148101817 17:45096918-45096940 GATGAGTAACTAGGCCAAATGGG + Intronic
1149258690 17:54855974-54855996 TATTATTAAAAAGGAAAAAGTGG + Intergenic
1152287703 17:79422269-79422291 GATGATTTACCAGGAAGACGAGG - Intronic
1152527657 17:80898368-80898390 GAGGATTAATCAGGAAAAAGGGG - Intronic
1153160594 18:2200386-2200408 GCTGATTAAGGAGGAAGAAGAGG + Intergenic
1153896957 18:9572169-9572191 GGTGATTATCTATGAGAAAGAGG + Intronic
1154504219 18:15019915-15019937 GGTGATTTACAAAGAAAAAGAGG + Intergenic
1155484140 18:26323255-26323277 GATGATCAATAAGGAAACAGAGG - Intronic
1156435968 18:37130101-37130123 GCTGATTAATTAAGAAATAGAGG + Intronic
1157563990 18:48667608-48667630 GATGAATAACTATGAAGGAGAGG + Intronic
1158120722 18:54045627-54045649 AAAGATTAACTAGGAGAAACAGG + Intergenic
1158163874 18:54517373-54517395 AATTATTAAGTAGGAAAAAGAGG - Intergenic
1158777063 18:60595537-60595559 GATGATTAACCAGAAGAAAGGGG - Intergenic
1159259904 18:66001022-66001044 TATGATTGAATAGGAAAAAGAGG + Intergenic
1159756037 18:72367304-72367326 AGTGATTAAATAGGAAAAAAGGG + Intergenic
1159882834 18:73875610-73875632 GCTGGTAAACTAGGTAAAAGTGG - Intergenic
1160203175 18:76811715-76811737 GATGATATGCTAAGAAAAAGGGG + Intronic
1161151364 19:2711777-2711799 GATGATTCCCTATGAAGAAGTGG - Intergenic
1165089608 19:33376873-33376895 GAAGATTAACCAAGTAAAAGGGG - Intronic
927181702 2:20451119-20451141 GAAAATCAATTAGGAAAAAGAGG + Intergenic
928407663 2:31027098-31027120 GATGAGAAACTAGGAAACACAGG + Intronic
928463942 2:31502512-31502534 GGTAATTTACAAGGAAAAAGAGG + Intergenic
928549842 2:32359215-32359237 GATTTTTAACTTGGAATAAGTGG + Intronic
928691324 2:33802161-33802183 GATCCTTAAGGAGGAAAAAGGGG - Intergenic
929065120 2:37964727-37964749 GATGATTAGTAAGGAAATAGAGG - Intronic
929249177 2:39733944-39733966 GATGATGAAATAGGAAAAAAGGG - Intergenic
930438276 2:51374684-51374706 GATGAATTGCTAGGAAAAAAAGG + Intergenic
931241647 2:60459505-60459527 GATGATTAACTAGGACATAATGG + Exonic
931851508 2:66255953-66255975 TATAATTAACTTGGTAAAAGGGG - Intergenic
933946742 2:87293140-87293162 GTTGAATAACTAGGAACAACAGG + Intergenic
936333448 2:111568396-111568418 GTTGAATAACTAGGAACAACAGG - Intergenic
937794974 2:126006157-126006179 TATTATTAACTAAGAAAATGAGG - Intergenic
938404532 2:131023125-131023147 AATTATTAAATAGGCAAAAGAGG + Intronic
938768692 2:134481565-134481587 GGTAATTTACAAGGAAAAAGAGG - Intronic
939034851 2:137118793-137118815 GATAATTAATAAAGAAAAAGAGG + Intronic
939458038 2:142463277-142463299 GGTCTTTAACTGGGAAAAAGTGG - Intergenic
940363053 2:152816186-152816208 GAGGATTAAATATTAAAAAGTGG - Intergenic
943932398 2:193870125-193870147 GATGATTAGCTACTAAAAAAGGG - Intergenic
944067742 2:195637031-195637053 TATTATTAACAAAGAAAAAGGGG + Intronic
944593579 2:201240629-201240651 GAAGATTAATAAGGAAACAGGGG + Intronic
945129427 2:206553075-206553097 GATGTTTAAAAAGGAAAAAAAGG + Intronic
945211808 2:207390948-207390970 GATGATTGACTTTGACAAAGTGG + Intergenic
946600458 2:221354939-221354961 GATAATTTACAAAGAAAAAGAGG + Intergenic
946858469 2:223977123-223977145 GGTAATTTACAAGGAAAAAGAGG - Intronic
947084521 2:226436275-226436297 GATGATTTATAAAGAAAAAGAGG + Intergenic
948450831 2:238070192-238070214 GATCATTAACTTGTAAAAATGGG + Intronic
1168747458 20:255852-255874 GATGATAGACTAGATAAAAGTGG + Intergenic
1169689867 20:8318453-8318475 GATGACTACCAAAGAAAAAGGGG - Intronic
1170018121 20:11806029-11806051 GATAATTTACGAAGAAAAAGAGG + Intergenic
1170660992 20:18339685-18339707 GAAGATTAATAAGGAAACAGAGG + Intergenic
1171002415 20:21428058-21428080 GTTAATTAACTGGGAAAAGGAGG - Intergenic
1171226649 20:23447071-23447093 GATGATCAAATAGGATAATGTGG - Intergenic
1171885646 20:30650317-30650339 TATGATTTACTTTGAAAAAGAGG + Intergenic
1172016260 20:31875474-31875496 GATCAGTAACTAGGAAAGAGTGG - Intronic
1172960691 20:38797263-38797285 GATCATTTACTAGGTAAAAGGGG - Intergenic
1173592900 20:44239277-44239299 GATAATTTACAAAGAAAAAGAGG - Intergenic
1175533483 20:59690647-59690669 GAGGATTTACTAGCAGAAAGAGG - Intronic
1177404692 21:20650064-20650086 CATGATTAAAAAGAAAAAAGTGG + Intergenic
1178757718 21:35368348-35368370 AATGAATAAATAGGGAAAAGGGG + Intronic
1181763870 22:25077319-25077341 GAGGATTAGCTAAGAATAAGGGG + Intronic
1182122331 22:27796298-27796320 GCTGACTAACTAGGAAAAGGTGG + Intronic
1183087700 22:35496861-35496883 GATGAGTAATTCGGAAAAATGGG - Intergenic
1183122463 22:35740659-35740681 GATGTTTAAGGAGGAGAAAGGGG - Intronic
1183336610 22:37251417-37251439 GGTAATTTACTAAGAAAAAGAGG + Intergenic
1183562585 22:38587852-38587874 GATTATACACTAGGAACAAGTGG + Intronic
1184383701 22:44162209-44162231 AATAATTAACCAGGAAAAAGAGG - Intronic
949676959 3:6466427-6466449 GATGCTTAAATAGGAAGATGAGG - Intergenic
950636539 3:14319432-14319454 GATTTTTAACTGGGAAAAACTGG + Intergenic
950826352 3:15826527-15826549 GGTGGTTACCTAGGAAAAAAGGG + Intronic
951183531 3:19686331-19686353 GAAGATTAAAAAGGAAATAGAGG + Intergenic
952235309 3:31473128-31473150 GGTGATTTACGAAGAAAAAGAGG - Intergenic
952570083 3:34703084-34703106 GATGATTTATAAAGAAAAAGAGG + Intergenic
952939192 3:38428568-38428590 GAATATTAACAGGGAAAAAGAGG - Intergenic
955100845 3:55848316-55848338 GAAGAATAATTAGGAAAAAGAGG - Intronic
955459180 3:59161715-59161737 GAAGATTAAATAAGAAAGAGTGG + Intergenic
955853155 3:63242810-63242832 GATGTTTAAATAGGTAAAAAAGG + Intronic
956087523 3:65628283-65628305 GATGATTCACTAGGAAGATTCGG + Intronic
956453110 3:69393376-69393398 GTTGATTAACTAGTAAAAATGGG - Intronic
957351536 3:79029253-79029275 CATTTTTCACTAGGAAAAAGGGG - Intronic
958144441 3:89605492-89605514 GAGTATTAACTAGTAAAATGAGG + Intergenic
958913104 3:100017435-100017457 GATGGTTAAAGAGGATAAAGTGG - Intronic
961849603 3:129802384-129802406 GATGGTGAACTAGGAAACATAGG + Intronic
962853522 3:139325319-139325341 GGTGATTTATAAGGAAAAAGAGG + Intronic
963923953 3:150931762-150931784 CATGGATAACTGGGAAAAAGAGG - Intronic
965135502 3:164761662-164761684 GATGATGAAATAGGAAAATGTGG + Intergenic
965605156 3:170491299-170491321 TATGATCAAGTAGGGAAAAGAGG + Intronic
966077715 3:175958186-175958208 GATCATCAACTGAGAAAAAGTGG + Intergenic
968336695 3:197919620-197919642 CATGATTTACTAATAAAAAGAGG + Intronic
970327342 4:14940861-14940883 GATATTCAATTAGGAAAAAGAGG + Intergenic
970363730 4:15337133-15337155 GGTGATTTATAAGGAAAAAGAGG + Intergenic
970919270 4:21374232-21374254 GCTAATTTACAAGGAAAAAGAGG + Intronic
971134670 4:23855215-23855237 GGTGATTTACAAAGAAAAAGAGG - Intronic
971481673 4:27120501-27120523 GATGATTTATAAAGAAAAAGAGG + Intergenic
972881253 4:43426020-43426042 GATGATAAAAGAGGAAAAGGAGG + Intergenic
975452935 4:74551271-74551293 AATAGTTAACTAGGAAAAAAAGG - Intergenic
975553806 4:75639942-75639964 GCTGATTAAATCAGAAAAAGAGG + Intergenic
977917658 4:102612092-102612114 GATGATTTACTAGCACAAGGTGG + Exonic
978567899 4:110103728-110103750 GATGAATCATAAGGAAAAAGAGG + Intronic
979410128 4:120367314-120367336 GAAGATTATCCAGGAAAGAGAGG + Intergenic
979606644 4:122645498-122645520 GCTGATAGACCAGGAAAAAGGGG + Intergenic
980973571 4:139589186-139589208 GGTAATTTACAAGGAAAAAGAGG + Intronic
981236691 4:142424793-142424815 GATGGTGAAACAGGAAAAAGAGG + Intronic
982067802 4:151669957-151669979 GCTGAGGAACTAGAAAAAAGTGG - Intergenic
982246617 4:153359177-153359199 GATGAACAAGTAGGAAACAGCGG - Intronic
983104118 4:163664405-163664427 CATGTTTAATTTGGAAAAAGGGG - Intronic
983312725 4:166085628-166085650 GATCATTCACTATGATAAAGTGG - Intronic
984107901 4:175573152-175573174 GATGATTAAATAAGAAAATGTGG - Intergenic
984257261 4:177403691-177403713 CATGATTCACCAGGAAAAACAGG + Intergenic
987571624 5:19670067-19670089 GGGAATGAACTAGGAAAAAGAGG + Intronic
987803954 5:22737982-22738004 TATGATTATCTGGGAAGAAGTGG + Intronic
988248556 5:28722932-28722954 GATTATTAACAAGGTTAAAGAGG + Intergenic
988430498 5:31113524-31113546 TAAGATTAAGTAGGACAAAGAGG + Intergenic
988531493 5:32031319-32031341 GATGACTAACTAGAGAAAAAGGG - Intronic
990251761 5:53923026-53923048 GATGATTAATTTTTAAAAAGTGG + Intronic
991051340 5:62275561-62275583 GATGATTAACTCTGCAAAAATGG - Intergenic
991163852 5:63538698-63538720 GATGTTTAATTAGGAAAAATTGG + Intergenic
991354055 5:65749150-65749172 GATAATTTATAAGGAAAAAGAGG - Intronic
991417749 5:66409304-66409326 GATAATTTACAAAGAAAAAGAGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993901425 5:93586021-93586043 GAAGCTTAGCTCGGAAAAAGAGG + Intronic
994704531 5:103185320-103185342 GTTGATAAACTATGAAATAGTGG + Intronic
994998459 5:107095806-107095828 GATATTTAACTGGGAAACAGTGG - Intergenic
995157999 5:108938667-108938689 GATGATTGATTGGGAGAAAGTGG + Intronic
995235101 5:109819946-109819968 GTAGATTAATTAGGCAAAAGGGG + Intronic
996211363 5:120815345-120815367 GATAATTTATTAAGAAAAAGAGG + Intergenic
996975202 5:129424398-129424420 GCTGATGAACTATGAAAGAGAGG - Intergenic
998301533 5:141026267-141026289 GATGATTAATTAGGGTAAATTGG + Intergenic
998518483 5:142778377-142778399 GATTGTTAGCTAGGAAAAGGGGG - Intronic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
1000238949 5:159391131-159391153 GATGATTTATGAAGAAAAAGAGG + Intergenic
1001723591 5:173877279-173877301 GATGATGACTTAGGAAAAACTGG + Intergenic
1002005711 5:176232628-176232650 GAAGAAGAACTAGGAAAGAGAGG + Intergenic
1002220668 5:177677996-177678018 GAGGAAGAACTAGGAAAGAGAGG - Intergenic
1002920761 6:1570899-1570921 GATGATTATATAAGAAGAAGAGG - Intergenic
1003635828 6:7830616-7830638 GATAATTTACAAAGAAAAAGAGG + Intronic
1003797719 6:9623709-9623731 GATGATTAAGTTAAAAAAAGGGG - Intronic
1004070045 6:12289472-12289494 GATGTTTTACTAGGACAAAAAGG - Intergenic
1004190990 6:13463258-13463280 GATGCTGCACTTGGAAAAAGGGG + Intronic
1005143018 6:22655780-22655802 GGTGATTAATTAGTAAAAATGGG + Intergenic
1005468494 6:26139221-26139243 GATGAAAAAGTAGGCAAAAGAGG - Intergenic
1006955144 6:37862952-37862974 GGTGATTAAATAAGAAATAGGGG - Intronic
1008668518 6:53742383-53742405 GATAATTTAATAGAAAAAAGGGG + Intergenic
1009877647 6:69525060-69525082 AAGAATTAACTAGTAAAAAGTGG - Intergenic
1010014802 6:71092009-71092031 GATGACCAACTAGTAAAATGAGG - Intergenic
1010095685 6:72041453-72041475 GATGCTTATCTATTAAAAAGCGG + Intronic
1010429281 6:75760241-75760263 TAAGATTAACTAGGTAAAATTGG - Intronic
1011023558 6:82841129-82841151 GATGTTAAAATAGGAAAAACTGG + Intergenic
1012324380 6:97896850-97896872 GTTGAATCAATAGGAAAAAGGGG - Intergenic
1012912273 6:105131942-105131964 GATAAATGACAAGGAAAAAGAGG - Intronic
1016829129 6:148416334-148416356 GATTATTAAATAGGATACAGAGG - Intronic
1017294322 6:152776643-152776665 GGGGATTAACTACTAAAAAGGGG + Intergenic
1018229277 6:161660503-161660525 GAAGATTCACAAGGAAAAAATGG + Intronic
1018356412 6:163021859-163021881 GATGCTTAACTCGGAATAACAGG - Intronic
1021741132 7:23686663-23686685 TATGATTATCAAGGAAAATGGGG + Intronic
1022218114 7:28284742-28284764 GGAGATTAACTTGGCAAAAGAGG + Intergenic
1022757253 7:33305254-33305276 GATGATTCATTAGGACCAAGTGG - Intronic
1030151825 7:106414155-106414177 GATGATTAACTACTAATAAAGGG + Intergenic
1030858407 7:114590746-114590768 AATGATTATCTAGGGAGAAGTGG + Intronic
1032189901 7:129758866-129758888 GATGATAAACTACGTAACAGAGG - Intergenic
1032770567 7:135050424-135050446 GATGATCAATAAGGAAACAGAGG - Intronic
1032977485 7:137242148-137242170 GATTATTAAATGGGAAAAAAGGG - Intronic
1036635085 8:10544063-10544085 GAAGATTAACAAGGATAAAGAGG - Intronic
1040393339 8:46969441-46969463 AACTATTAACAAGGAAAAAGTGG + Intergenic
1040518764 8:48156734-48156756 GATAATTAATAAGGAAACAGTGG + Intergenic
1041206617 8:55505795-55505817 GAAGATTAATAAGGAAATAGAGG - Intronic
1042052133 8:64722653-64722675 GATGCTTACCTAGGAAAACTGGG + Intronic
1043824972 8:84916315-84916337 TATCATTAACTCTGAAAAAGAGG + Intronic
1045220466 8:100194214-100194236 GAAGATGAAGAAGGAAAAAGCGG + Exonic
1046152158 8:110241585-110241607 GTTGATGAACTAAGAAAAATAGG + Intergenic
1046810469 8:118527736-118527758 CAAGATTAAGTAGGAATAAGTGG - Intronic
1047632500 8:126723623-126723645 GATGGAAAACTAGGAAACAGAGG + Intergenic
1048558043 8:135500859-135500881 AATGATTAACTAGGAATTAGTGG + Intronic
1048736436 8:137507180-137507202 CAAGATTAACTAGCAAGAAGTGG + Intergenic
1050147240 9:2582398-2582420 GATAATTAACAAGGAAAGACTGG + Intergenic
1050945296 9:11510087-11510109 GGTGATTTACAAAGAAAAAGAGG - Intergenic
1051698153 9:19790362-19790384 AATGATGACATAGGAAAAAGGGG - Intergenic
1051711683 9:19936795-19936817 GATGATAAATGGGGAAAAAGAGG + Intergenic
1051741285 9:20254786-20254808 GATGATTTATAAAGAAAAAGAGG + Intergenic
1052366353 9:27615808-27615830 AAAGATTCACTAGGAAAAGGAGG + Intergenic
1052678513 9:31658013-31658035 GGTAATTTACAAGGAAAAAGAGG + Intergenic
1052877416 9:33577570-33577592 TATGATTCATTATGAAAAAGAGG - Intergenic
1053127280 9:35592410-35592432 GATGGTGATCTAGGAATAAGGGG + Intergenic
1053498571 9:38566639-38566661 TATGATTCATTATGAAAAAGAGG + Intronic
1056073996 9:83019896-83019918 AATGATTATCTGGCAAAAAGGGG + Intronic
1059582252 9:115564868-115564890 GATAATTTACAAAGAAAAAGAGG + Intergenic
1060063532 9:120482731-120482753 GATGATTAAGTAGGTAAGAGGGG + Intronic
1188355807 X:29189437-29189459 CAAGAAAAACTAGGAAAAAGAGG - Intronic
1189412757 X:40788433-40788455 GAGGATTGAGGAGGAAAAAGAGG + Intergenic
1189980265 X:46503390-46503412 AATGACTAAAGAGGAAAAAGCGG + Intronic
1192276477 X:69636400-69636422 GGTGATTTACTAATAAAAAGAGG - Intronic
1194319864 X:92432065-92432087 GATCATTAACTACGATAAAATGG - Intronic
1194394842 X:93370220-93370242 GATGATTGACAAAGAAACAGTGG - Intergenic
1195476067 X:105287240-105287262 GAGCATTAACTAGGAAAGACAGG + Intronic
1195786069 X:108525031-108525053 GAAGATCAACAAGGAAATAGAGG - Intronic
1197481383 X:126990992-126991014 GATTATCAATTAGGAAAAATGGG - Intergenic
1198168998 X:134086656-134086678 GTAGATTAACAAAGAAAAAGAGG + Intergenic
1199564649 X:149202213-149202235 GAAGATCAATTAGGAAATAGAGG - Intergenic
1199591132 X:149469384-149469406 GCTCATGAACAAGGAAAAAGAGG + Intergenic
1200627990 Y:5545198-5545220 GATCATTAACTACGATAAAATGG - Intronic
1200947641 Y:8862771-8862793 GCTTATAAACTAGGGAAAAGGGG - Intergenic
1201606651 Y:15792970-15792992 GAAGATTAAATAATAAAAAGGGG - Intergenic
1201922738 Y:19252440-19252462 GTTGCTTATCTAGGAAAAACAGG + Intergenic