ID: 1144472606

View in Genome Browser
Species Human (GRCh38)
Location 17:15558183-15558205
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144472606_1144472610 1 Left 1144472606 17:15558183-15558205 CCTTCTGCTCTCGATCCCAACAG 0: 2
1: 0
2: 0
3: 14
4: 115
Right 1144472610 17:15558207-15558229 CTAATCGCCATCCAGCGGCCAGG 0: 2
1: 0
2: 0
3: 2
4: 28
1144472606_1144472609 -4 Left 1144472606 17:15558183-15558205 CCTTCTGCTCTCGATCCCAACAG 0: 2
1: 0
2: 0
3: 14
4: 115
Right 1144472609 17:15558202-15558224 ACAGTCTAATCGCCATCCAGCGG 0: 2
1: 0
2: 0
3: 4
4: 63
1144472606_1144472611 2 Left 1144472606 17:15558183-15558205 CCTTCTGCTCTCGATCCCAACAG 0: 2
1: 0
2: 0
3: 14
4: 115
Right 1144472611 17:15558208-15558230 TAATCGCCATCCAGCGGCCAGGG 0: 2
1: 0
2: 0
3: 1
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144472606 Original CRISPR CTGTTGGGATCGAGAGCAGA AGG (reversed) Intronic
900571648 1:3361602-3361624 CTCCTCGGATCGGGAGCAGATGG + Intronic
905043595 1:34979105-34979127 CAGTTGGGATTGACAGCAGCAGG - Intergenic
905473204 1:38208169-38208191 CTGCTGGGATGGAGACCAGAGGG + Intergenic
908385888 1:63641371-63641393 CTGTTGTGAACGAGTGCAGCTGG + Intronic
908456591 1:64310217-64310239 CTGCTGGGACCTAGAACAGAAGG + Intergenic
914918569 1:151832754-151832776 CAGCTGGGAACGAGAGCAGGAGG - Intergenic
915267392 1:154728815-154728837 CTGATGGGATTGAGAGAGGAAGG + Intronic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917242133 1:172959926-172959948 ATGGTCGGATGGAGAGCAGAAGG + Intergenic
917596551 1:176534992-176535014 CTGATGGGAACCAGAGCACAAGG - Intronic
1067528162 10:47050857-47050879 CTGTTGGGAGACAGAGCAGTAGG - Intergenic
1071031566 10:81190218-81190240 CTGTTGGGAAGGAAAGCAGCAGG + Intergenic
1074551335 10:114445102-114445124 CTGCTGGGCTCTAGAGGAGATGG - Intronic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077864473 11:6211159-6211181 CTTCTGGGATCCAGAGAAGAGGG + Intergenic
1081491752 11:43574950-43574972 CTCTTCGGGTGGAGAGCAGAGGG + Intronic
1081729341 11:45358156-45358178 CATTTGGGATGGAGGGCAGAGGG + Intergenic
1081729457 11:45359532-45359554 GTGTTGGGATGGAGAGGTGATGG + Intergenic
1085261861 11:75210307-75210329 CTGTTGGATTCCAAAGCAGAGGG - Intergenic
1087270889 11:96110433-96110455 CTGTTGGGATAGAGAAAAGGAGG - Intronic
1088406476 11:109485405-109485427 ATGTTGGGATAGAGAGTAGAAGG + Intergenic
1088755122 11:112879146-112879168 CTGTTGTGATGGACAGCGGAAGG + Intergenic
1091046460 11:132330106-132330128 CTGTTAAGGTCGAAAGCAGACGG - Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095269250 12:40197136-40197158 GTGTTGGGAAAGAGGGCAGAGGG - Intronic
1097248090 12:57617666-57617688 CTGGTGGGGTCTAGACCAGAGGG - Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1104839747 12:131817473-131817495 CTGTTGGGATGATGAGCGGACGG - Intergenic
1105020964 12:132816689-132816711 GTGGTGGGATCGAGAGACGACGG + Exonic
1109274152 13:60285798-60285820 CTGTTGGGATGGGGTGCAGGGGG + Intergenic
1116012501 14:39367334-39367356 CTGTTGAGCCCTAGAGCAGAAGG + Intronic
1116645516 14:47523749-47523771 CTGTTGTGATCGTGTGCTGAAGG - Intronic
1123725281 15:23095489-23095511 CTGCTGGGCTCTAGACCAGAGGG - Intergenic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1126142694 15:45450851-45450873 CAGCTGGGATCGGGATCAGAGGG - Intergenic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1133813601 16:9179717-9179739 ATGGTGGGAGTGAGAGCAGAAGG + Intergenic
1134558873 16:15190222-15190244 CTGTTGGGAGTGAAAGCACATGG - Intergenic
1134919405 16:18101823-18101845 CTGTTGGGAGTGAAAGCACATGG - Intergenic
1137589624 16:49685677-49685699 CAGTGGGGACCGAGAACAGAGGG - Intronic
1138209961 16:55155270-55155292 CTGTTGGCATCTGGGGCAGAGGG - Intergenic
1142344517 16:89545462-89545484 CTGTTGGGATGGAGAGTGAAGGG + Intronic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1149380363 17:56087469-56087491 CAGTAGGTATCTAGAGCAGAAGG - Intergenic
1157866129 18:51186390-51186412 CAGATGGGAAGGAGAGCAGAGGG + Intronic
1158219811 18:55139029-55139051 GTGTTGGGATCCCGAGAAGATGG + Intergenic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161695609 19:5765978-5766000 CTGTTGGGATCCAGGCCACATGG + Intronic
1162028472 19:7907263-7907285 GTGTTGGGAGAGAGAGTAGATGG + Intronic
1162221276 19:9178823-9178845 CCCTTGGGATCAAGAGCAAATGG - Intergenic
1163741826 19:19019021-19019043 CTGATGGTATTGAGAGCAGAGGG - Intronic
1164598842 19:29547837-29547859 CTGTAGGGAACCAGAGCACATGG + Intronic
1164790151 19:30970642-30970664 CTGGTGTGGTCTAGAGCAGAAGG - Intergenic
1164880326 19:31727480-31727502 CTGTTGGGAGCAGGTGCAGAGGG - Intergenic
1165173119 19:33906947-33906969 CTGTTGGGGGCCAGAGCAGGAGG + Intergenic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167862742 19:52298204-52298226 CTGGTGACAACGAGAGCAGAGGG + Intronic
925027060 2:618370-618392 CTGTCAGTGTCGAGAGCAGAGGG + Intergenic
927758359 2:25727102-25727124 CTGTTGGGGTCGGGGGCAGAGGG - Intergenic
929033768 2:37672056-37672078 CTGTTGGGATCGGGAGAGGTGGG - Exonic
932022824 2:68105021-68105043 CTGCTGGGGTAGAGAGGAGAGGG - Intronic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
944324946 2:198393164-198393186 CTATTGGGATGGAGGGCACATGG + Intronic
1169330518 20:4712645-4712667 CTGCTGGTATCAAGAGCTGATGG + Intergenic
1169932968 20:10853798-10853820 CTCTTGGGATTGACAGCAGTAGG - Intergenic
1172912896 20:38423151-38423173 CTTTTGGAAGCGAAAGCAGAAGG + Intergenic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176922670 21:14707205-14707227 CTGTTGGATTAGTGAGCAGAAGG - Intergenic
1178644336 21:34373028-34373050 CTGTCTGGATGCAGAGCAGAGGG - Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1184045324 22:41969477-41969499 CTGGTGGGACAGTGAGCAGAGGG + Intergenic
950833393 3:15897198-15897220 CTTTTGAGACCCAGAGCAGAGGG + Intergenic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
955598499 3:60618417-60618439 CTGCTGGGAGGGAGAGCATAAGG - Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
963567943 3:146953959-146953981 CTTTTGGGAAAGTGAGCAGATGG - Intergenic
964434732 3:156639664-156639686 CTGTAGGGAATGAGATCAGAGGG - Intergenic
964629298 3:158792466-158792488 ATGTTAGGATCAAGAGGAGAGGG - Intronic
966830764 3:184006424-184006446 CTGTTAGGAAGGAGAGCAGGAGG - Intronic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
968268674 3:197382614-197382636 CTGTTGGGCAGCAGAGCAGAGGG + Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
975912955 4:79290451-79290473 CTGATGAGAGAGAGAGCAGAGGG - Intronic
989547578 5:42692380-42692402 CTTTTGGGAGTAAGAGCAGAGGG + Intronic
989753336 5:44922073-44922095 CTGTTGGGAACTAGAGTAGATGG + Intergenic
992835042 5:80631807-80631829 GTGATGGGAGCCAGAGCAGACGG - Intronic
994419086 5:99509923-99509945 CTGTTGAGAAATAGAGCAGACGG + Intergenic
998149553 5:139748966-139748988 CTGTTGGGATGGAGTGCAGGTGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1006786244 6:36669279-36669301 CTGATGGGAGGGGGAGCAGAAGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008649695 6:53549868-53549890 TTGTTGGGATCCAGAACACATGG + Intronic
1013665770 6:112346767-112346789 GTGTCTGTATCGAGAGCAGAAGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022374584 7:29801662-29801684 CTTATGGGATGGGGAGCAGATGG - Intergenic
1023582993 7:41701362-41701384 CTGATGGGATCCAGGGGAGATGG + Intronic
1030007062 7:105130205-105130227 CTGTTGGGAATGAGAGCTGACGG - Intronic
1030380709 7:108808266-108808288 CTGTTCTGATCGAGAGTGGATGG - Intergenic
1030462346 7:109855028-109855050 CTCTTGTGATTGAGAACAGATGG + Intergenic
1035470125 7:159104369-159104391 CTGTTGGGAACTGGAGCAGTGGG - Intronic
1035692710 8:1570738-1570760 CTTCTGGGATGGAGAGGAGAGGG + Intronic
1035692926 8:1571768-1571790 CTTCTGGGATGGAGAGGAGACGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1043651975 8:82607545-82607567 CTGTTGGGATTGAAAGCTGATGG - Intergenic
1046194014 8:110835271-110835293 CTTTTGGGATCTGGATCAGAAGG - Intergenic
1049700954 8:144012314-144012336 CTGGTGGCATGGAGAGCTGAGGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054983119 9:71230276-71230298 TTGTGCAGATCGAGAGCAGAAGG + Intronic
1060624246 9:125095986-125096008 CTGTTGGGAGTGAGAGCACAGGG - Intronic
1061790920 9:133058414-133058436 CGGTTGGGATCCAGAGCTAAAGG - Exonic
1062726385 9:138076326-138076348 TTGGTGGGATCGAGGGCAGTAGG + Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1196521356 X:116676416-116676438 GTGTTGTGTTGGAGAGCAGAGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic