ID: 1144473061 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:15561754-15561776 |
| Sequence | CTCCATCTTCAATAGGAGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2375 | |||
| Summary | {0: 5, 1: 323, 2: 745, 3: 735, 4: 567} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144473057_1144473061 | 21 | Left | 1144473057 | 17:15561710-15561732 | CCTGGGCGCAGGTTCAAATGTCA | 0: 2 1: 0 2: 1 3: 3 4: 80 |
||
| Right | 1144473061 | 17:15561754-15561776 | CTCCATCTTCAATAGGAGCTGGG | 0: 5 1: 323 2: 745 3: 735 4: 567 |
||||
| 1144473056_1144473061 | 25 | Left | 1144473056 | 17:15561706-15561728 | CCGGCCTGGGCGCAGGTTCAAAT | 0: 2 1: 0 2: 0 3: 8 4: 109 |
||
| Right | 1144473061 | 17:15561754-15561776 | CTCCATCTTCAATAGGAGCTGGG | 0: 5 1: 323 2: 745 3: 735 4: 567 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144473061 | Original CRISPR | CTCCATCTTCAATAGGAGCT GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||