ID: 1144473061

View in Genome Browser
Species Human (GRCh38)
Location 17:15561754-15561776
Sequence CTCCATCTTCAATAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2375
Summary {0: 5, 1: 323, 2: 745, 3: 735, 4: 567}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144473057_1144473061 21 Left 1144473057 17:15561710-15561732 CCTGGGCGCAGGTTCAAATGTCA 0: 2
1: 0
2: 1
3: 3
4: 80
Right 1144473061 17:15561754-15561776 CTCCATCTTCAATAGGAGCTGGG 0: 5
1: 323
2: 745
3: 735
4: 567
1144473056_1144473061 25 Left 1144473056 17:15561706-15561728 CCGGCCTGGGCGCAGGTTCAAAT 0: 2
1: 0
2: 0
3: 8
4: 109
Right 1144473061 17:15561754-15561776 CTCCATCTTCAATAGGAGCTGGG 0: 5
1: 323
2: 745
3: 735
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144473061 Original CRISPR CTCCATCTTCAATAGGAGCT GGG Intronic
Too many off-targets to display for this crispr