ID: 1144478818

View in Genome Browser
Species Human (GRCh38)
Location 17:15612209-15612231
Sequence AAGAAGAGGAAGTGTCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144478811_1144478818 7 Left 1144478811 17:15612179-15612201 CCCATCCAACACATGAGTAAAGC 0: 2
1: 0
2: 0
3: 8
4: 121
Right 1144478818 17:15612209-15612231 AAGAAGAGGAAGTGTCGGGCTGG 0: 1
1: 0
2: 0
3: 34
4: 324
1144478812_1144478818 6 Left 1144478812 17:15612180-15612202 CCATCCAACACATGAGTAAAGCA 0: 2
1: 0
2: 1
3: 13
4: 173
Right 1144478818 17:15612209-15612231 AAGAAGAGGAAGTGTCGGGCTGG 0: 1
1: 0
2: 0
3: 34
4: 324
1144478814_1144478818 2 Left 1144478814 17:15612184-15612206 CCAACACATGAGTAAAGCAAGGC 0: 2
1: 0
2: 0
3: 14
4: 153
Right 1144478818 17:15612209-15612231 AAGAAGAGGAAGTGTCGGGCTGG 0: 1
1: 0
2: 0
3: 34
4: 324
1144478810_1144478818 10 Left 1144478810 17:15612176-15612198 CCACCCATCCAACACATGAGTAA 0: 2
1: 0
2: 0
3: 10
4: 177
Right 1144478818 17:15612209-15612231 AAGAAGAGGAAGTGTCGGGCTGG 0: 1
1: 0
2: 0
3: 34
4: 324
1144478809_1144478818 20 Left 1144478809 17:15612166-15612188 CCAAATCAATCCACCCATCCAAC 0: 2
1: 0
2: 0
3: 57
4: 469
Right 1144478818 17:15612209-15612231 AAGAAGAGGAAGTGTCGGGCTGG 0: 1
1: 0
2: 0
3: 34
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144478818 Original CRISPR AAGAAGAGGAAGTGTCGGGC TGG Intronic
900931169 1:5738744-5738766 AAGATGAGGAAGAGTTGGTCAGG + Intergenic
901572683 1:10174402-10174424 AAAAAGAAGAAGTATTGGGCTGG + Intronic
901692784 1:10984453-10984475 AAGAAGAGGAAAATTGGGGCCGG - Intergenic
902150230 1:14436981-14437003 AAGAAGCTGAAGTGTCAGGCAGG - Intergenic
902558955 1:17265057-17265079 AAGAAGAAGCAGTGAGGGGCAGG - Intronic
903228333 1:21906474-21906496 AAGAAGAGGAAGGGGCAGGCAGG + Intronic
903368270 1:22818217-22818239 AAGAAGAGGTCGTGGGGGGCTGG - Intronic
903451946 1:23459677-23459699 CAGAAGAGGAAGAGTGGTGCTGG + Intronic
904537181 1:31207594-31207616 AAGAAGAACAAGAGTGGGGCAGG - Intronic
905192892 1:36249485-36249507 AAGAATAGGGACTGTGGGGCTGG - Intronic
905500556 1:38433172-38433194 AAGAAGAGGAGATGGCAGGCAGG + Intergenic
906117952 1:43367990-43368012 CAGATGAGGAAGTGGCAGGCAGG - Intronic
906134163 1:43483844-43483866 AAGAAAAAGAAGTTTTGGGCTGG - Intergenic
906189329 1:43885713-43885735 AACAACAGGAAATGTCGGGGTGG - Intronic
906672419 1:47666043-47666065 AGGAAGAGGGAGTGTCTGGAGGG - Intergenic
907809247 1:57852067-57852089 AAGAAGAGGAAGGGACAGGAGGG - Intronic
907976637 1:59437105-59437127 AAGAAGAGAAACTGTCAGGAAGG - Intronic
908125877 1:61029835-61029857 AAGAAGAAGAAGTATGGGCCAGG + Intronic
908565147 1:65346617-65346639 CAGATGAGGAAGGGTGGGGCAGG - Intronic
910122212 1:83802753-83802775 AAGACAAGGAAGTCTGGGGCTGG + Intergenic
910862375 1:91754601-91754623 AAGAAGGGAACGTGTCAGGCAGG - Intronic
912367764 1:109149131-109149153 GAGAAGAGGGCGCGTCGGGCAGG + Intronic
912432237 1:109634870-109634892 GAGGAGAGGAGGTGGCGGGCTGG - Intergenic
913265637 1:117040709-117040731 ATGAAGAGAAAGTATCGGTCTGG + Intergenic
915488203 1:156236493-156236515 AGGAAGAGGAAGAGGCAGGCTGG - Intronic
915523759 1:156464001-156464023 AGGAAGAGGAAGGGAGGGGCAGG - Exonic
917514816 1:175698542-175698564 AATAAGAGGTGGTGTCGGCCGGG + Intronic
918506740 1:185263080-185263102 AAGAAGAGAAAATTTGGGGCTGG - Intronic
920577039 1:207069038-207069060 AAGAAAAAGAAATGTCGGCCGGG - Intronic
920648970 1:207822814-207822836 AATCAGAGGAAGTGTCTGGAGGG + Intergenic
920751053 1:208677497-208677519 AAGAAGAGGACATGTAGGGCTGG - Intergenic
922966465 1:229694969-229694991 CAGAAGTGGAAGTGTGGGGTGGG - Intergenic
923329267 1:232907481-232907503 AAGAAGAAGAAGTAAGGGGCTGG + Intergenic
923426858 1:233879159-233879181 AAGAAGAGAAAGGCTGGGGCAGG + Intergenic
923441512 1:234024964-234024986 AAGAAGAGGGAGGGTGGGACAGG - Intronic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
924877542 1:248121995-248122017 AAGAAGAGGAAGGTGCGGGTGGG - Intergenic
1064134017 10:12735179-12735201 AAGAAACGAAAGTGTCGGCCGGG + Intronic
1064276354 10:13909015-13909037 AAGAATAGGAAGTGTTGGGGAGG - Intronic
1065034607 10:21624967-21624989 AAGAGGAGGAAGGGGAGGGCAGG - Intronic
1065476711 10:26146035-26146057 AAGAAGAGAAGGTGCCAGGCTGG + Intronic
1067508103 10:46873507-46873529 AAGATGAGGGAGTGATGGGCTGG - Intergenic
1067654147 10:48178338-48178360 AAGATGAGGGAGTGATGGGCTGG + Intronic
1069901505 10:71709066-71709088 AAGGAGAGGAAGCTTCCGGCTGG - Intronic
1069914101 10:71776658-71776680 AAGAAGAGGAAGTGATGTTCTGG + Intronic
1070530761 10:77335267-77335289 AAGAAGAGGCAGTGTGGAACAGG - Intronic
1074503398 10:114045195-114045217 AAGAAGACGAAGAGGCGGTCGGG - Exonic
1075998691 10:126898003-126898025 AAGCAGAGGAAATTTAGGGCTGG - Intergenic
1081573837 11:44307388-44307410 AAGTAGAGGAAGGGCCAGGCTGG + Intronic
1081682899 11:45021195-45021217 GAGAAGAGGAAGTGGAGGGGGGG + Intergenic
1081954208 11:47075620-47075642 AAGAATTGGAGGTGTCGGCCAGG + Intronic
1083720660 11:64602061-64602083 AGGCAGAGGATGTGGCGGGCAGG - Exonic
1084357130 11:68647326-68647348 CAGAAGACAAAGTGTAGGGCTGG - Intergenic
1084473117 11:69374699-69374721 ATGCAGAGGAAGTGTCTGGTGGG - Intergenic
1085151852 11:74258659-74258681 AAGGAGAGGAGGGGTGGGGCAGG + Intronic
1085496160 11:76971745-76971767 AAGAAGAGGAAAGGCCTGGCTGG + Intronic
1086788586 11:91005002-91005024 AAGAAGAGGAAGAGTTGAGTAGG + Intergenic
1086867953 11:92002867-92002889 AGAAAGAGGAAGTGTGGGGATGG + Intergenic
1089283546 11:117391292-117391314 AAGAAGGGCAAGTCTCGGGTGGG + Intronic
1089968492 11:122673226-122673248 AAGAAAAGGAACTGTTGAGCTGG + Intronic
1091209000 11:133841029-133841051 AAGAACAGGAAGTGCTGGGAGGG - Intronic
1091473578 12:752188-752210 AAGAAGAGGAACGAGCGGGCGGG - Intergenic
1091517683 12:1200851-1200873 AAGAAAAGGAAATGTGGGCCGGG - Intronic
1092060695 12:5548100-5548122 GGGAAGAGGAAATGTGGGGCTGG - Intronic
1095729242 12:45488206-45488228 AAGAATAGGTAGTCTCGGCCGGG + Intergenic
1095730508 12:45501462-45501484 AGGAAGAGGAAGTGAGGGGAAGG - Intergenic
1096191931 12:49624903-49624925 AGCAAGAGGAAGAGTAGGGCTGG + Intronic
1096232212 12:49902972-49902994 AAGAAGGGGGAGTGTAGGGGAGG + Intronic
1096233556 12:49910775-49910797 AAGAAGCCGAAGCCTCGGGCAGG + Intergenic
1100322690 12:93510891-93510913 AAGGAGAGAAAGTTTCAGGCAGG + Exonic
1101139746 12:101783006-101783028 CAGCAGAGGAAGTGTCGGCCAGG - Intronic
1101256642 12:102984362-102984384 ATGATGAGGAAGTGTCAGCCAGG + Intergenic
1101492595 12:105223129-105223151 AAGATGAGGAGGTGACGGGAAGG + Intronic
1104434508 12:128745119-128745141 AAGAAGAGAAAGTTTGGGGGTGG + Intergenic
1105256158 13:18745090-18745112 GAGAAGAGGGAGTGCAGGGCTGG + Intergenic
1105984440 13:25551497-25551519 AAGATGGGTAAGTGTCGGGGTGG + Exonic
1106029768 13:25989619-25989641 AAGAAAAGGAAATGTCAGCCAGG - Intronic
1106637158 13:31541460-31541482 AATAGGAGAAAGTGTTGGGCTGG + Intergenic
1108112421 13:47089940-47089962 AAGAAAAGGATGTGTCCAGCTGG - Intergenic
1108202546 13:48057644-48057666 AAGAAGAGGGAATGGAGGGCGGG - Intronic
1108647334 13:52443430-52443452 AAGAAGAGGAAGAGACAGGAGGG + Intronic
1110122504 13:71900726-71900748 GAGAAGAGGAAGTGTCTAGGAGG - Intergenic
1111341158 13:86888282-86888304 AAGTAGAGCAAATGTCTGGCTGG + Intergenic
1111500222 13:89109167-89109189 AAGAAGAGATAGTGTTGGGGAGG + Intergenic
1112299164 13:98214263-98214285 AGGAAGTGGGAGTGTCTGGCTGG + Intronic
1113383655 13:109827657-109827679 AAGAAAAGAATGTTTCGGGCTGG - Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114355422 14:21902977-21902999 AAGAACAAGAAGTGTGGGGAAGG - Intergenic
1114600377 14:23951563-23951585 AAGAACAGGAAATCTTGGGCTGG - Intergenic
1116201899 14:41808181-41808203 AAGAAGAGGAAGTAGAGGGAAGG + Intronic
1116232421 14:42234675-42234697 AAGAAAAGAAAGTGTGGGGGTGG - Intergenic
1116351665 14:43871352-43871374 AAGGAGAGGAAATGGTGGGCAGG - Intergenic
1116439214 14:44932231-44932253 AAGAAGAGGAAGAGAGGGGTGGG + Intronic
1118174496 14:63424454-63424476 AAGAAGAGAAAGGGTCGGCCGGG + Intronic
1118517203 14:66543620-66543642 AGGAAGAGCAAGTGTTAGGCAGG - Intronic
1118760625 14:68878569-68878591 AGGAAGAGGAAGGGCCGGCCCGG + Intronic
1119214247 14:72856431-72856453 AGGAAGAGGAAGTGGGGTGCTGG + Intronic
1119387377 14:74266078-74266100 AAGATGAGGAGGAGTCTGGCTGG + Intergenic
1119738619 14:76999671-76999693 AAGAATAGGAATGGTGGGGCGGG + Intergenic
1121448637 14:93994050-93994072 AAGAAGAGGAAGAGCCAGGGCGG + Intergenic
1122120341 14:99549956-99549978 CAGAAGAGGCAGTGTAGTGCGGG + Intronic
1202835854 14_GL000009v2_random:76938-76960 GAGAAGAGGGAGTGCAGGGCTGG - Intergenic
1124178707 15:27452686-27452708 AAGAAGAGGAAGGGTTGGTCTGG + Intronic
1124622491 15:31282122-31282144 AAGAAGAGGAAGAGAGAGGCTGG - Intergenic
1125001047 15:34770247-34770269 AAGAAGAGGAAGGGTCAGAAAGG - Intergenic
1127516694 15:59701135-59701157 AAGAAGAGGCAGTCTTGGCCAGG - Intergenic
1130408733 15:83626315-83626337 GAGGAGAGGAAGTGACTGGCTGG - Intergenic
1131200996 15:90395765-90395787 AAGAAGAGAACGTGTCAGGCAGG + Intronic
1131822408 15:96286173-96286195 AAGGAGAGGAAGTGCTGGGAAGG + Intergenic
1132567972 16:631822-631844 AAGGAGAGGCAGTGACGGGGTGG - Intronic
1132568042 16:632103-632125 AAGGAGAGGCAGTGACGGGGTGG - Intronic
1133061290 16:3175997-3176019 AAGAAGAGGAAATTCAGGGCAGG - Intergenic
1134235161 16:12459495-12459517 AAGAAGAGGAAGTGGATGGCAGG + Intronic
1135161099 16:20097116-20097138 AAAAGGAAGAAGTGTGGGGCTGG - Intergenic
1136484941 16:30565634-30565656 AAGAAGACGTGGTGTCGGGGTGG + Intergenic
1137061759 16:35797107-35797129 AGGAAGAGGAAGTATAGGACAGG - Intergenic
1137567958 16:49545365-49545387 ATGAAGAGGAGGCGCCGGGCAGG + Intronic
1138001328 16:53282909-53282931 AAGAAGAGTAAGTGACGAGAAGG - Intronic
1138142892 16:54583652-54583674 AAGAAAAGAAAGTGGTGGGCTGG + Intergenic
1138499989 16:57435185-57435207 AAAGAGAGGAAGAGTCGGGGTGG - Intronic
1138774548 16:59705869-59705891 AAGAAGAGAAGGTGTCTGCCAGG + Intergenic
1139435825 16:66935888-66935910 AAGCACAGAAAGGGTCGGGCTGG + Intronic
1139503358 16:67386455-67386477 AAGAAGAGGCAGAGGCAGGCCGG + Intergenic
1139520731 16:67481314-67481336 AAAAAGAGGAAGTTTGAGGCCGG + Intergenic
1140104415 16:71946702-71946724 AAGAAGTGGATTTGTGGGGCAGG + Intronic
1141469057 16:84226168-84226190 AAGAAGAGCAAGCGTCAGCCTGG + Intronic
1141683751 16:85558495-85558517 AGGAGGAGGAAGTGTCAGGCTGG + Intergenic
1142130771 16:88430579-88430601 AGGAAGAGGAAGGCTCGGGGCGG + Exonic
1203017811 16_KI270728v1_random:368062-368084 AAGAAGAGGGGGTGTCTGGAAGG + Intergenic
1203036146 16_KI270728v1_random:641220-641242 AAGAAGAGGGGGTGTCTGGAAGG + Intergenic
1142839454 17:2615733-2615755 AAAAAGAGAAAGTTTCAGGCTGG - Intronic
1143310597 17:5985387-5985409 AAGAAGAGGAAATTTGGGCCGGG + Intronic
1143846455 17:9775903-9775925 AAGAAGAGGAAATTTGGGGCCGG + Intronic
1143892369 17:10112350-10112372 AACAAGAGGAAGACTCAGGCAGG + Intronic
1144354241 17:14428883-14428905 AAGAAGAGGAAGTGAGGGGGAGG - Intergenic
1144478818 17:15612209-15612231 AAGAAGAGGAAGTGTCGGGCTGG + Intronic
1145222276 17:21099243-21099265 GAGAAGAGGAATTAACGGGCAGG + Intergenic
1146558474 17:33847841-33847863 AAGAAGATCAAGTGTTAGGCAGG + Intronic
1147169749 17:38611010-38611032 AAAAAAAGGAATTGTCGGGGTGG + Intergenic
1148639757 17:49178011-49178033 AAGAAAAGAAAGTGTTGGTCAGG + Intergenic
1149744751 17:59085533-59085555 AAAAAGAGCAAGTGTTGGCCAGG + Intronic
1152355739 17:79806350-79806372 TAGAAGAGGAAGTGGCCAGCAGG + Intergenic
1152879739 17:82808246-82808268 AAGATGCTGAAGTGTCGGGGAGG + Intronic
1153170688 18:2312502-2312524 AAGAAGAGGAGGAGTGGGGCAGG + Intergenic
1153226386 18:2903169-2903191 AAGAGGAGGGAGGGTGGGGCTGG + Intronic
1153539727 18:6140565-6140587 AAGGAGGGGAAGTGCTGGGCAGG - Intronic
1155352809 18:24923658-24923680 AAGAAAAGGAAGTTTCTGGAGGG - Intergenic
1158516763 18:58137370-58137392 AAGAACAGGAAGTTTCTGGAGGG + Intronic
1160176206 18:76597143-76597165 AAAAAGTGAAAGTGTCGGCCAGG + Intergenic
1161904031 19:7141821-7141843 AAGGAGAGGAAGTGAGAGGCAGG + Intronic
1162797978 19:13096364-13096386 AAGAGGAGGGAGTGACGGGAGGG + Intronic
1162902491 19:13803483-13803505 AATAAGAGCAAGTGTTGGGCTGG + Intronic
1162933572 19:13969195-13969217 AAGGAGAGGAAGAGAGGGGCGGG + Intronic
1162968164 19:14165487-14165509 AAGATGAGGAAGGGTCTGTCTGG + Intronic
1164769195 19:30795290-30795312 AAGATGAGTGAGTGTCAGGCAGG - Intergenic
1165966426 19:39584656-39584678 AAGCATACGAAGTGTTGGGCAGG - Intergenic
1166294645 19:41883099-41883121 AGGAAGCGGAGGTGCCGGGCGGG + Intergenic
1166544827 19:43627658-43627680 AAGAAGAGGGTCTGCCGGGCTGG + Exonic
1166576476 19:43843815-43843837 AAGAAATGGTAGTGTCTGGCAGG - Intronic
1166967824 19:46540892-46540914 AAGAAGAGGAAATTTAGGCCGGG - Intronic
1167958893 19:53090331-53090353 AAGCTGAGAAAGTGTGGGGCAGG - Intronic
1202636783 1_KI270706v1_random:50425-50447 GAGAAGAGGGAGTGCAGGGCTGG + Intergenic
925670139 2:6302536-6302558 AAGCAGAGGAAGTGTCAGAGAGG + Intergenic
926052958 2:9756504-9756526 AAGAGCAGGGAGTGACGGGCAGG - Intergenic
926222828 2:10947545-10947567 CAGAGGAGGTAGTGTGGGGCTGG - Intergenic
929078525 2:38098491-38098513 AAAAAAAGGAAGTGTGGGGAGGG + Intronic
930018213 2:46985181-46985203 AAGAAGAGGAAGGGAGGGGGTGG - Intronic
930244497 2:48969349-48969371 AAGAGGAAGAAGAGTCTGGCAGG + Intronic
931196748 2:60058997-60059019 AAGAAGAGGAAGTACCAGGATGG + Intergenic
931448851 2:62350602-62350624 ATGATGATGATGTGTCGGGCAGG - Intergenic
931474491 2:62573274-62573296 AAGAGGAGGAAGTGCTGAGCAGG + Intergenic
931945040 2:67297030-67297052 AAGCAGAGGTAGAGTGGGGCTGG + Intergenic
932217492 2:69976291-69976313 AGGAGGAGGCAGTGTGGGGCTGG - Intergenic
933289922 2:80426623-80426645 AAGAAGAGGAAGTCTCTGAATGG - Intronic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
934859116 2:97749302-97749324 AAAAATAGGAAGTGTCAGCCGGG - Intergenic
934983241 2:98865079-98865101 AACAAGAGGAGGTGGTGGGCTGG + Intronic
935029067 2:99304642-99304664 AAGAAGATGAAGTTTTAGGCTGG + Exonic
939657684 2:144848132-144848154 AAGCAGAGGAAGAGTCTGCCAGG - Intergenic
940178887 2:150909576-150909598 AAGAAGAGGAACTTTAAGGCAGG - Intergenic
941779939 2:169432905-169432927 AAGAAGAGAATGTTTTGGGCAGG - Intergenic
942062523 2:172240877-172240899 GAGGAGAGAAAGTGTTGGGCTGG - Intergenic
942123271 2:172799758-172799780 AAGAAGAGGAAATCTCGAGAAGG + Intronic
943661029 2:190559590-190559612 AAGAAGAGGACGTTTCAGGAGGG + Intergenic
944494632 2:200294530-200294552 AAGAAGTGGAAGTGGTGGACAGG - Intergenic
944546353 2:200802733-200802755 AAGAAGTGGAATTGCCGGCCAGG - Intergenic
944600444 2:201297821-201297843 GAGAAAAGCAAGTGTTGGGCAGG + Intronic
944668200 2:201973898-201973920 AAAAAAAGGAAGTTTCAGGCTGG + Intergenic
945033754 2:205686812-205686834 AAGAACAGGAAGTGGAGGGAGGG - Intronic
945243655 2:207698864-207698886 AAGAAGAGGAAGTTTGTGCCAGG - Intergenic
946169852 2:217888421-217888443 AAGCAGAGGCAGTGTCAGACAGG + Intronic
946960236 2:224977338-224977360 AAGAAAAGCAAGTGTTGGTCAGG - Intronic
947885203 2:233563901-233563923 AAGATGGTGAAGTGTAGGGCGGG - Intronic
947958698 2:234216535-234216557 AAGAAGAAGAAGTGTGAGACTGG - Intergenic
948440478 2:237984029-237984051 AAGAAGAGGAGGAGTAGGGGAGG - Intronic
1169278849 20:4250362-4250384 AAGGCGAGGAGGTGTGGGGCTGG + Intergenic
1170206583 20:13805137-13805159 AAGTATAGGAGGTGTAGGGCTGG + Intronic
1171189575 20:23149633-23149655 AGGAAGAGGAAGAGTCAGACAGG - Intergenic
1171880896 20:30616841-30616863 GAGAAGAGGGAGTGCAGGGCTGG + Intergenic
1172414228 20:34751073-34751095 AAGAATGTGAAGTGTCGGCCGGG + Intronic
1172599155 20:36171721-36171743 ATGAAAAGGAAGTGTGGGGCGGG + Intronic
1174055140 20:47793477-47793499 AAGAAGAGAAAGTGGGGGCCAGG + Intergenic
1174396343 20:50249071-50249093 AAGAAAAGGAAATGTGGGTCAGG + Intergenic
1174462389 20:50691857-50691879 AAGAAGAGGAAGGAGAGGGCTGG - Intergenic
1174635780 20:51998300-51998322 AAGAAGAGGAGGTGGAGGCCGGG - Intergenic
1175786079 20:61712516-61712538 AAGAAGAGGAGGAGCTGGGCAGG - Intronic
1176363348 21:6016915-6016937 AAGAAGAGGGAGAGTTGGCCGGG + Intergenic
1176842161 21:13850114-13850136 GAGAAGAGGGAGTGCAGGGCTGG + Intergenic
1177238070 21:18419518-18419540 AAAAAGAGGAAATGTCGGCCGGG - Intronic
1177678505 21:24334484-24334506 AGGAAGAGGAAGAGGAGGGCAGG + Intergenic
1178096109 21:29217450-29217472 AATAAGAGGACGTGTGGGCCGGG + Intronic
1178507678 21:33176309-33176331 AAGAAGAGACTGTGTAGGGCTGG - Intergenic
1178549691 21:33526161-33526183 AAGAAAAGGAAGTTCCCGGCTGG - Intronic
1178846099 21:36175404-36175426 AAGAAGAGGAAATCTGGGCCAGG - Intronic
1178973142 21:37199017-37199039 AAGAAGAGGAAGTGCCAGACCGG - Intronic
1179760170 21:43521630-43521652 AAGAAGAGGGAGAGTTGGCCGGG - Intergenic
1180167032 21:46035695-46035717 AAAAACAGGAACTGTCGGCCCGG + Intergenic
1180364088 22:11923888-11923910 GAGAAGAGGGAGTGCAGGGCTGG - Intergenic
1181015546 22:20066516-20066538 AAGAAGGGGAAGAGACGGGGAGG - Intergenic
1182106756 22:27695209-27695231 AAGAGGAGAAAGAGGCGGGCAGG + Intergenic
1183021705 22:35032763-35032785 AAGAAGAGGAAGAGGAGGACGGG + Intergenic
1183699064 22:39439723-39439745 AAGCAGAGGAAGCCTTGGGCTGG - Intergenic
1184104016 22:42357089-42357111 GAGAAGAGGAAGGGTGGGCCAGG + Intergenic
1184797385 22:46739941-46739963 AAGAAGAGGAAATGTTGACCGGG + Intergenic
949877058 3:8633454-8633476 AAAAAGAACAAGTGTCAGGCCGG - Intronic
950122957 3:10493984-10494006 ATGAAGGTGAAGTGTGGGGCTGG + Intronic
951267633 3:20588243-20588265 AAGAAGAGGAAATTTGAGGCCGG - Intergenic
952247369 3:31608819-31608841 AAGAAAAGGATGTGTTGGCCAGG + Intronic
953458289 3:43061317-43061339 CAGAAGAGGAACTGTCAGGGTGG - Intergenic
953927666 3:46990593-46990615 CAGAGGAGGAAGAGTAGGGCTGG - Intronic
954063044 3:48084931-48084953 AAGAAGGGGGATTGTAGGGCTGG - Intronic
955293794 3:57716917-57716939 AAGAAGAGGAAGAGACAGGCAGG - Intergenic
955897940 3:63720732-63720754 AAGAAGAGGAAAGGTGGGACAGG + Intergenic
960884563 3:122381427-122381449 AAGAAGAGGAAGAGATAGGCTGG + Intronic
962374744 3:134850563-134850585 AGGATGGGGAAGTGTGGGGCAGG + Intronic
963282927 3:143404579-143404601 AAAAAGAGTATGTGTGGGGCGGG - Intronic
963652053 3:147992229-147992251 AAGAAGGGGAAGTGAATGGCAGG + Intergenic
964707508 3:159635248-159635270 AAGCAGAGGAGCAGTCGGGCAGG + Intronic
964858064 3:161169016-161169038 AAGAAGAGGCTGTGTAGGTCAGG - Intronic
964881245 3:161425840-161425862 AAGAAGAGGAGGTGAGGGGAGGG + Intergenic
966805590 3:183805101-183805123 AAGAATAAGAAGGGTTGGGCCGG + Intronic
966908795 3:184546338-184546360 GAGATGAGGAAGTTTCGGGGAGG - Intronic
967024743 3:185554887-185554909 AAGAAAAGAAAGCGGCGGGCCGG - Intergenic
968216225 3:196893612-196893634 AAGAAGAGTAAGTTTAGGCCGGG + Intronic
969197493 4:5574625-5574647 AAAAAGATGAAGTGACGTGCTGG + Intronic
971000533 4:22317422-22317444 AAGACAAGGAATTGTCGGCCGGG + Intergenic
971336356 4:25727345-25727367 TAGAAGAGGAAATTTGGGGCAGG - Intergenic
971347385 4:25823731-25823753 AAGAAAACAAAGTGTCAGGCAGG + Intronic
972718627 4:41674184-41674206 AGGAGGAGGAAGTGTGGGGTGGG - Intronic
973394021 4:49578640-49578662 GAGAAGAGGGAGTGCAGGGCTGG - Intergenic
973996909 4:56467738-56467760 AATAAGAGTAAGTGTCGGGGTGG + Exonic
974649604 4:64737761-64737783 AAGAAGAGGTAGTTTCTGTCAGG + Intergenic
974679640 4:65144977-65144999 AAGGAGAGCAACTGTCGGACTGG - Intergenic
980922656 4:139102543-139102565 AAAAAAAGGAAGTATCGGCCGGG + Intronic
982747621 4:159121335-159121357 AAGAAGAGGAAGGGGAGGGGAGG - Intronic
983274642 4:165602768-165602790 AAGAACAGGAAGTGCCGAGGAGG - Intergenic
1202764098 4_GL000008v2_random:136296-136318 GAGAAGAGGGAGTGCAGGGCTGG + Intergenic
986228858 5:5843109-5843131 AAGAAGAGGAAGTCATGGGAAGG + Intergenic
986647377 5:9930598-9930620 AAGAAGAGGAAGAGTTGGCCGGG - Intergenic
988563331 5:32300338-32300360 AAGAAAAGGAAGTCTCGGATAGG + Intronic
988718029 5:33847325-33847347 AAAAACAGGAAGTTTCGGCCAGG + Intronic
989556824 5:42806622-42806644 AAGAGGAGGAAGTGTGGAGGAGG + Intronic
990246368 5:53867266-53867288 AAGAAAAGGAAGTTTATGGCTGG + Intergenic
990397409 5:55396479-55396501 AAGAGGAGGAAGAGGCAGGCAGG + Intronic
992733049 5:79691159-79691181 CAGAAGAGGGAGTGTTGGGCTGG + Intronic
995683160 5:114743314-114743336 AAGGATAGGAAGTGTGGGACTGG - Intergenic
996641233 5:125756919-125756941 AAAAACAGAAAATGTCGGGCTGG + Intergenic
997399219 5:133589567-133589589 AAGAAGAGAAATTGTTGGGGAGG + Intronic
997951157 5:138243574-138243596 AGGAAGAGGAAATGGCTGGCTGG - Intergenic
998331036 5:141327342-141327364 AAGAGGAGGAGGTGGCGAGCAGG - Intergenic
1000643928 5:163738501-163738523 CAGAAAAGAAAGTGTCAGGCAGG + Intergenic
1001265189 5:170269069-170269091 AAAATGAGGAAGTGTCAGGGAGG - Intronic
1002130925 5:177081230-177081252 AAGAAGAGGAAGAGTAAGGAAGG + Intergenic
1004262913 6:14123873-14123895 AAGAAGAGGAAGTTTGGAGAAGG + Intronic
1004588819 6:17029238-17029260 AAGAGGAGGAAGGGTGGGGCAGG + Intergenic
1006599461 6:35215841-35215863 GAAAAGAGGCAGTGTGGGGCTGG - Intronic
1007395627 6:41576053-41576075 AAGAGGAGGAAGGGTGGGGGGGG - Intronic
1007478092 6:42132551-42132573 AAGAAAAGGAGGTGTGGGGCTGG + Intronic
1008826222 6:55697539-55697561 AAGATTAGGTAGAGTCGGGCAGG + Intergenic
1010191651 6:73202362-73202384 AAAAAGAGGAAGGGACGGCCGGG - Intergenic
1010244415 6:73650062-73650084 AAGAAAATAAAGTGTTGGGCTGG + Intronic
1010362556 6:75011810-75011832 AAGAAGAGGTAGAGATGGGCAGG - Intergenic
1011447166 6:87453571-87453593 AAGAAGCGGCAGTGGCTGGCTGG + Intronic
1012558145 6:100542384-100542406 AAGAAAAACAACTGTCGGGCCGG + Intronic
1014835645 6:126157192-126157214 AAGAAGAGGAAGTGTGGACGAGG - Intergenic
1016070618 6:139733821-139733843 AATAAGAGAAGGCGTCGGGCAGG + Intergenic
1016401927 6:143690161-143690183 AACAAGAGAAAGTGTGGGGATGG - Intronic
1016932623 6:149425688-149425710 AAGACGAGGAGGTGTTGGGTAGG - Intergenic
1017014415 6:150088715-150088737 AAGAGGGGGAAGTGTCAGGATGG + Intergenic
1018528389 6:164737403-164737425 AAGAAAAAGAAGTTTAGGGCCGG - Intergenic
1018573544 6:165234774-165234796 ATGAAGTGGAAGTGACGGGAAGG - Intergenic
1019083570 6:169453394-169453416 AAAAAGAGTAAGTCTAGGGCTGG + Intergenic
1020105395 7:5420304-5420326 AAGAAGAGAGCGGGTCGGGCAGG - Intronic
1021444484 7:20717730-20717752 AAGAAGAGGAAATTTGGGCCAGG - Intronic
1021993359 7:26157124-26157146 AAGAAAAGAAACTGTTGGGCTGG + Intronic
1022387533 7:29915679-29915701 AAGAAGAGGGAGTGAAGAGCAGG - Exonic
1022572160 7:31465458-31465480 ACCAAGAGGAAGTGTGTGGCTGG + Intergenic
1022742933 7:33140318-33140340 AAGAAGAGGAGGAATCCGGCTGG - Intronic
1023369567 7:39499515-39499537 AAGAAGAGAAGGTGTGTGGCCGG - Intergenic
1023902857 7:44497338-44497360 AAGAGGAGATAGTGTAGGGCTGG + Intergenic
1024548092 7:50539013-50539035 GAGAAGAGCAAGTGCCAGGCTGG + Intronic
1024563255 7:50661928-50661950 CAGAACAGGAAGTCTAGGGCCGG - Intronic
1025237853 7:57246667-57246689 AAGAAGAGAAAGTGGGGGCCAGG - Intergenic
1029503634 7:100949362-100949384 AAGTCCAGGAAGTGTCAGGCAGG - Intergenic
1030109211 7:106012285-106012307 TAGGAGAGGAAGTACCGGGCAGG + Intronic
1030879135 7:114854457-114854479 AAGAAGAGCCAGTGCCGGGCAGG + Intergenic
1032095761 7:128937927-128937949 AAGACGCGGAAGTGCCCGGCAGG + Exonic
1033290149 7:140076644-140076666 AAGAAGAGGAAATTTAGGCCAGG + Intergenic
1033534773 7:142301519-142301541 AAGAAAAGGAAGTCTCTGGTTGG + Intergenic
1033672029 7:143502442-143502464 AAGAAGAAGAAGTGTGGGTGTGG + Intergenic
1033879284 7:145861743-145861765 AAGAAGAGGAAGAGTGGGAGGGG + Intergenic
1034861053 7:154595163-154595185 ATGGAGAGGACGTGTCAGGCAGG - Intronic
1035183247 7:157106091-157106113 AAGAAAAGGAGGTTTAGGGCGGG - Intergenic
1035422353 7:158740260-158740282 CAGAGGAGGAAGGGTAGGGCAGG - Intronic
1036371675 8:8167931-8167953 CACAAGAGGAAGTGTCGTGTCGG + Intergenic
1036450669 8:8864368-8864390 AAGAGGAGGAGGAGTCGGGCAGG - Intronic
1036879228 8:12497713-12497735 CACAAGAGGAAGTGTCGTGTCGG - Intergenic
1038060349 8:23905444-23905466 AAGAAGAGGAAATGTGGGGAGGG - Intergenic
1038516787 8:28194128-28194150 TAGAAGAGGAAGAGTGGGGCCGG - Intergenic
1041465909 8:58157514-58157536 AAGAATAGCAAGTGTCTTGCAGG + Intronic
1041863796 8:62545034-62545056 AAGAAGAGGAGGAGTTGGTCTGG + Intronic
1042831427 8:73033432-73033454 AAGAAAAGGAAATGTAGGCCAGG + Intronic
1042949418 8:74185586-74185608 AAGAAAAGCAAGTGTCTGGGTGG + Intergenic
1044644228 8:94421066-94421088 AAGCAGAGGCAGTGTGGGGGTGG - Intronic
1045421097 8:102015937-102015959 AAAAAGAAGAAGGGTGGGGCTGG + Intronic
1046505506 8:115132635-115132657 AAGAAGAGCAGGTGTGGGGAAGG - Intergenic
1047711464 8:127556644-127556666 AACAAGACGATGTGTGGGGCCGG - Intergenic
1048516553 8:135116736-135116758 AAGAAGAGGAAGGGAAGGGCAGG - Intergenic
1049593048 8:143471313-143471335 CAGAAGAGGCAGTGTGGGGCGGG + Intronic
1051065808 9:13101320-13101342 AAGAACAGGAATTGACTGGCTGG + Intergenic
1053047214 9:34929823-34929845 AAGAGGATGAAGAGTCGGGGAGG - Intergenic
1055691833 9:78840504-78840526 AAGAAGAGGAAAAATAGGGCAGG + Intergenic
1055985858 9:82056238-82056260 GAGAAGAGGGAGTGCAGGGCTGG - Intergenic
1056585479 9:87924880-87924902 AAGAAGAGGGAGCGCAGGGCTGG + Intergenic
1056611401 9:88128063-88128085 AAGAAGAGGGAGCGCAGGGCTGG - Intergenic
1057372451 9:94486609-94486631 AAGAAGAGGAACTTCCTGGCTGG + Intergenic
1057759418 9:97860575-97860597 CAGAAGAGGGAGTGTGGGGCTGG - Intergenic
1059803570 9:117774552-117774574 AAGAAGAGGAAGAGAAGGACAGG - Intergenic
1060142227 9:121220176-121220198 AAGAAAAGGCAGTGTGGGCCGGG - Intronic
1060369368 9:123055526-123055548 AAGAAGAAGAAATATCTGGCTGG - Intronic
1061594972 9:131623062-131623084 TTAAAGAGGAAGTGTGGGGCTGG - Intronic
1062256489 9:135625038-135625060 TAGAAAAGTAAGTGTCGGCCGGG - Intronic
1203544845 Un_KI270743v1:121169-121191 GAGAAGAGGGAGTGCAGGGCTGG + Intergenic
1186459022 X:9733670-9733692 AAGAAGAGGAATTGAGGGACAGG + Intronic
1187254271 X:17628042-17628064 AGGAAGAGGAAGTGCCAGCCTGG + Intronic
1187269360 X:17765729-17765751 AAAAACAGGAAGTGCCAGGCAGG - Intergenic
1189806473 X:44740234-44740256 AAGAAGAAGAAGTGTTTGGCAGG + Intergenic
1190692606 X:52924019-52924041 AAAAAGAGGAGCTGTTGGGCTGG - Intergenic
1191171594 X:57453406-57453428 AAGAAGAGGAACTGCTGGGCTGG - Intronic
1191716223 X:64195494-64195516 AACAACAGGAAGTGACCGGCAGG + Intronic
1192177807 X:68896731-68896753 AGGAACAGGAAGTGCTGGGCCGG + Intergenic
1193427363 X:81355654-81355676 AGGAAGAGGAAGTGTAGGACAGG - Intergenic
1194646878 X:96468665-96468687 AAGAAGAGGAAGGGAGGGGAGGG + Intergenic
1196026674 X:111048633-111048655 ATGAAGAGGATGTGTTGGGTGGG - Intronic
1196174436 X:112625534-112625556 AAGAATAAGAAGTGTTGGTCAGG + Intergenic
1196246717 X:113408531-113408553 AAGAAGAGGAAGGGAAGGGAAGG - Intergenic
1197980833 X:132217409-132217431 AAGAAGAGGAAGTTACAGGAGGG + Exonic
1200146981 X:153931433-153931455 AAGAAGAGGGACTGTTGGGAAGG - Intronic
1200298710 X:154950058-154950080 AAGAAGAGGAAATGTGGGCCAGG - Intronic