ID: 1144480307

View in Genome Browser
Species Human (GRCh38)
Location 17:15623330-15623352
Sequence TGCCCCCAATATGTCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 2, 1: 0, 2: 1, 3: 27, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144480307_1144480310 4 Left 1144480307 17:15623330-15623352 CCTGCATGGACATATTGGGGGCA 0: 2
1: 0
2: 1
3: 27
4: 233
Right 1144480310 17:15623357-15623379 AACAGCAGGTTGCCCTGCAAGGG 0: 2
1: 0
2: 0
3: 7
4: 143
1144480307_1144480308 -10 Left 1144480307 17:15623330-15623352 CCTGCATGGACATATTGGGGGCA 0: 2
1: 0
2: 1
3: 27
4: 233
Right 1144480308 17:15623343-15623365 ATTGGGGGCATATCAACAGCAGG 0: 2
1: 0
2: 1
3: 10
4: 64
1144480307_1144480309 3 Left 1144480307 17:15623330-15623352 CCTGCATGGACATATTGGGGGCA 0: 2
1: 0
2: 1
3: 27
4: 233
Right 1144480309 17:15623356-15623378 CAACAGCAGGTTGCCCTGCAAGG 0: 2
1: 0
2: 1
3: 21
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144480307 Original CRISPR TGCCCCCAATATGTCCATGC AGG (reversed) Intronic