ID: 1144480307 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:15623330-15623352 |
| Sequence | TGCCCCCAATATGTCCATGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 263 | |||
| Summary | {0: 2, 1: 0, 2: 1, 3: 27, 4: 233} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144480307_1144480310 | 4 | Left | 1144480307 | 17:15623330-15623352 | CCTGCATGGACATATTGGGGGCA | 0: 2 1: 0 2: 1 3: 27 4: 233 |
||
| Right | 1144480310 | 17:15623357-15623379 | AACAGCAGGTTGCCCTGCAAGGG | 0: 2 1: 0 2: 0 3: 7 4: 143 |
||||
| 1144480307_1144480308 | -10 | Left | 1144480307 | 17:15623330-15623352 | CCTGCATGGACATATTGGGGGCA | 0: 2 1: 0 2: 1 3: 27 4: 233 |
||
| Right | 1144480308 | 17:15623343-15623365 | ATTGGGGGCATATCAACAGCAGG | 0: 2 1: 0 2: 1 3: 10 4: 64 |
||||
| 1144480307_1144480309 | 3 | Left | 1144480307 | 17:15623330-15623352 | CCTGCATGGACATATTGGGGGCA | 0: 2 1: 0 2: 1 3: 27 4: 233 |
||
| Right | 1144480309 | 17:15623356-15623378 | CAACAGCAGGTTGCCCTGCAAGG | 0: 2 1: 0 2: 1 3: 21 4: 174 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144480307 | Original CRISPR | TGCCCCCAATATGTCCATGC AGG (reversed) | Intronic | ||