ID: 1144482520

View in Genome Browser
Species Human (GRCh38)
Location 17:15639597-15639619
Sequence TCTGGACAACAGGGCTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144482520_1144482529 2 Left 1144482520 17:15639597-15639619 CCTCCGGAGCCCTGTTGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1144482529 17:15639622-15639644 TGGCCCTCACCCTTGGGAGGAGG 0: 2
1: 0
2: 7
3: 24
4: 241
1144482520_1144482527 -4 Left 1144482520 17:15639597-15639619 CCTCCGGAGCCCTGTTGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1144482527 17:15639616-15639638 CAGAGCTGGCCCTCACCCTTGGG 0: 1
1: 1
2: 1
3: 27
4: 214
1144482520_1144482526 -5 Left 1144482520 17:15639597-15639619 CCTCCGGAGCCCTGTTGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1144482526 17:15639615-15639637 CCAGAGCTGGCCCTCACCCTTGG 0: 1
1: 0
2: 4
3: 33
4: 406
1144482520_1144482528 -1 Left 1144482520 17:15639597-15639619 CCTCCGGAGCCCTGTTGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1144482528 17:15639619-15639641 AGCTGGCCCTCACCCTTGGGAGG 0: 1
1: 2
2: 2
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144482520 Original CRISPR TCTGGACAACAGGGCTCCGG AGG (reversed) Intronic
900396409 1:2454929-2454951 CCTGGACAACAGGTTTCTGGGGG - Intronic
900397750 1:2460171-2460193 CCTGGACAGCAGGGCCCCTGGGG - Intronic
901958546 1:12806778-12806800 ACTGGAAAACAGGCCTCAGGTGG + Intergenic
902100774 1:13986792-13986814 TCTAGACACGAGGGCCCCGGTGG - Intergenic
903911631 1:26731161-26731183 TATGGACAACAAGGCCCCAGCGG + Exonic
904211322 1:28888179-28888201 TCTGGAGGAAAGGGCTCCAGAGG - Intronic
904851288 1:33461589-33461611 TCTGGAGAACTGGGGTCAGGGGG + Intergenic
905175838 1:36134846-36134868 TCTGAAAACCAGGGGTCCGGTGG + Intergenic
924616168 1:245613684-245613706 CCTGGACAACAGTACTCCTGGGG + Intronic
1067346987 10:45444062-45444084 GCTGGGCAGCAGGGCTTCGGGGG + Intronic
1067809458 10:49416098-49416120 TCTGGACTAGAGGGGTCCAGGGG - Intergenic
1075731480 10:124639168-124639190 TCTGGACCACAGGGATTCAGAGG + Intronic
1081610765 11:44561972-44561994 CCTGGACAAGAGGGCACCTGTGG + Intergenic
1083632653 11:64103790-64103812 TCTGGACCCCAGGACTCCCGAGG - Exonic
1084204733 11:67584820-67584842 TTTAAACAAAAGGGCTCCGGGGG - Intronic
1087097465 11:94333032-94333054 TCTGGGAAACAGGGCTCAGTGGG - Intergenic
1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG + Intronic
1105773978 13:23639489-23639511 TGTGCACAGCAGGGCTCCTGAGG - Intronic
1112883133 13:104133994-104134016 GATGGGCAACAGGGCTCCAGAGG + Intergenic
1113406768 13:110047991-110048013 GCTGGACACCAGAGCTCCTGTGG + Intergenic
1113984359 13:114301926-114301948 CCAGGACAGCGGGGCTCCGGGGG + Exonic
1115311605 14:31984449-31984471 TCTGGGCCACAGGGCTCCCTTGG + Intergenic
1115535850 14:34372686-34372708 TCTGGACAACAGGGCAATGCTGG + Intronic
1117078079 14:52124097-52124119 TCTGGACACAAGGGCTCCTTGGG + Intergenic
1118571573 14:67200029-67200051 TCTGGACACCCAGGCTCTGGGGG + Intronic
1119074802 14:71626354-71626376 TCTGGACTAAAGAGCACCGGGGG + Intronic
1119167757 14:72509394-72509416 TCTAGACAGCAAGGCTCCAGAGG - Intronic
1125933004 15:43613289-43613311 TCTAGACAGCAGGGCTACAGAGG - Intronic
1125946103 15:43712751-43712773 TCTAGACAGCAGGGCTACAGAGG - Intergenic
1127848365 15:62891393-62891415 TGTGGAGAACAGGGCTGTGGTGG - Intergenic
1127885450 15:63195704-63195726 TCTGGACATCAGCTCTCCTGTGG + Intronic
1130632006 15:85579094-85579116 TCTGTGCAACAGGGCTCCCTGGG - Exonic
1131904751 15:97130935-97130957 TCTGGAGGGCAGGGCTCCCGAGG + Intergenic
1132368755 15:101277811-101277833 ATTGGACAACAGGGCTCAGTTGG + Intergenic
1135732715 16:24907996-24908018 CCTGGACCACAGGGATCCAGAGG - Exonic
1139467962 16:67164281-67164303 TCTGGACGACACAGCTGCGGGGG + Intronic
1139963021 16:70728728-70728750 TCTGGAGAACTGGGCTGAGGTGG - Intronic
1141280733 16:82627829-82627851 GCTGGACAATAGGGGTGCGGGGG - Intronic
1141369258 16:83472178-83472200 TCTGGACAACAGTGAGCCTGAGG - Intronic
1143774509 17:9189201-9189223 TCTGTAAAACAGGGGTCGGGGGG - Intronic
1144325703 17:14177783-14177805 TCTGGAGAAAAGTGCTCCAGAGG + Intronic
1144425085 17:15133764-15133786 GCTGGACAACAGGCCTCAGGAGG + Intergenic
1144474577 17:15574671-15574693 TCTGGAGAAAAGTGCTCCAGAGG + Intronic
1144482520 17:15639597-15639619 TCTGGACAACAGGGCTCCGGAGG - Intronic
1144613387 17:16745837-16745859 CCAGGACAGCGGGGCTCCGGGGG - Intronic
1144734676 17:17548383-17548405 TCTGGAGACCAGGGGTCTGGGGG + Intronic
1144916162 17:18725434-18725456 CCTGAACAAAAGGGCTCCGGAGG + Intronic
1145133051 17:20375913-20375935 CCAGGACAGCGGGGCTCCGGGGG - Intergenic
1145347306 17:22049178-22049200 GGTGGACATCAGGGCTCAGGTGG - Intergenic
1148545617 17:48516626-48516648 TCTGGAAATCAGGTCTCAGGAGG + Intergenic
1148795600 17:50195257-50195279 TCTGGACCCCAGGGCCCCGGCGG - Exonic
1150307720 17:64100419-64100441 TCTGTACAACAGGTCTTGGGAGG + Intronic
1153651039 18:7240495-7240517 CCTGGACAGCAAGGCTCAGGGGG + Intergenic
1159037012 18:63286932-63286954 TCTGAACTACAGGTCTCCCGAGG + Intronic
1161412147 19:4122955-4122977 TCTGGGCAAGGGGGCTCCAGAGG - Intronic
1162017400 19:7853006-7853028 CCAGGGCAACAGGGCTCGGGCGG + Intronic
1162564104 19:11435659-11435681 GCTGGACAAGAGGGGTGCGGTGG + Intronic
1163319059 19:16561715-16561737 TCTGGAGAACAGGACTGCGACGG + Intronic
1163613282 19:18311846-18311868 ACAGGACAACAGGGCTCGAGGGG - Intronic
1163667269 19:18609143-18609165 TTTGGGAAACAGGGCTCCAGTGG - Intronic
1166045983 19:40231604-40231626 TCTGCACAGCAGGGCTCAGCAGG + Exonic
1167101656 19:47407489-47407511 TCTGGCCCACCGGGGTCCGGGGG + Exonic
932276250 2:70454339-70454361 TTTGGACAGCAGGGCTAAGGAGG + Intronic
937154255 2:119707591-119707613 TCTGGACAGCAGGGCCCTTGGGG - Intergenic
937900535 2:127016097-127016119 GCTGGACAACAGGGTCCCGCGGG + Intergenic
937911785 2:127079085-127079107 ACTGGCCACCAGGGCTCCTGAGG + Intronic
941419466 2:165264524-165264546 TCTGTACAACAGTTCTCAGGGGG - Intronic
942418284 2:175781416-175781438 TCTGGATAGCACGGCTCCAGGGG - Intergenic
945554416 2:211261936-211261958 CCTGGACAATAAGTCTCCGGAGG + Intergenic
947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG + Intronic
948392384 2:237621769-237621791 TCTGGAAAACAGCCCTCTGGAGG - Intergenic
949067510 2:242002151-242002173 GCTGTAGAACAGGGCCCCGGTGG - Intergenic
1170451351 20:16487355-16487377 CCTGGACAACAGGAATCCAGAGG + Intronic
1172703511 20:36866231-36866253 TGAGAACAACAGGGCTCTGGTGG + Intergenic
1176654388 21:9576622-9576644 GGTGGACATCAGGGCTCAGGTGG + Intergenic
1178403405 21:32306138-32306160 GCTGGGCTACAGCGCTCCGGTGG - Intronic
1182466666 22:30521131-30521153 TCTGGACAAGAGGTCTCTGCAGG + Intergenic
1183520839 22:38295285-38295307 GCTGGACAGCAGGGCACCTGGGG - Intronic
1184301592 22:43563932-43563954 TCTGGGCAGCAGGGCTGTGGGGG + Intronic
1185332789 22:50259179-50259201 TCTGGCCCACGTGGCTCCGGCGG - Intronic
1185363572 22:50423754-50423776 GCTGGACTACAGGTCTCTGGCGG + Intronic
950523230 3:13508654-13508676 TCTGGACAACAAGGGTGCTGAGG - Intergenic
953032009 3:39185542-39185564 TCTGGCCAGCAGGGCTGCTGTGG + Exonic
953356877 3:42263671-42263693 GCTGGGCAACAGAGCTCCTGCGG + Intronic
953624166 3:44557083-44557105 TCTGGAAAGCAGTGCTCCTGGGG - Exonic
954436009 3:50496710-50496732 TCTGTAAAACAGGGCTTCCGTGG - Intronic
961360440 3:126364109-126364131 TGTGGACAACAGTGCTCAAGAGG - Intergenic
962829064 3:139123679-139123701 TCTGGAAACCAGGTCTCCTGGGG - Intronic
968061804 3:195731530-195731552 TCTGGACCTCAGAGCTCCTGGGG - Intronic
969315700 4:6380393-6380415 GCTGGACAACAAGCCCCCGGGGG + Intronic
969681028 4:8643605-8643627 TCTGGAGACCAGGCCTCCGCAGG + Intergenic
979859715 4:125678156-125678178 TCTGGACAGCAGGAATCTGGAGG + Intergenic
982222903 4:153140118-153140140 ACTGGACAAGAGGGGTCAGGTGG - Intergenic
983929295 4:173435423-173435445 TCTGGTCACCGGGGCTCCGAGGG + Intergenic
995557059 5:113340656-113340678 TCTGCACATCCGGGCTCTGGAGG + Exonic
1001654825 5:173341242-173341264 TCTGGACCACAGGGCAGCAGGGG + Intergenic
1001687380 5:173604245-173604267 GCTGGACAAAATGGCTCAGGGGG + Intergenic
1001910681 5:175514940-175514962 TCTGGAAATCAGGGCTCAGTAGG - Intronic
1004963594 6:20821359-20821381 TCTGGACTACAAGCCTCCAGAGG - Intronic
1006297721 6:33177419-33177441 CCTGGACAACAGGGCACCCCTGG - Exonic
1008931945 6:56949919-56949941 TGAGGACAACAGGGCTTAGGTGG + Intronic
1010055570 6:71560206-71560228 TCTGCACAACAGGGATGCTGAGG - Intergenic
1013583546 6:111559253-111559275 TCTGCACAACAGGTTTCCTGGGG + Exonic
1023819858 7:43974649-43974671 TGTGAACAACAGGGAACCGGCGG + Intergenic
1024996685 7:55277992-55278014 TGTGGACGACAGGGCTCAGTGGG + Intergenic
1029161055 7:98552213-98552235 TCTGGACACCAAGGCTCAGGTGG + Intergenic
1029748130 7:102528102-102528124 TGTGGACAACAGGGAACCGGCGG + Intergenic
1029766077 7:102627189-102627211 TGTGGACAACAGGGAACCGGCGG + Intronic
1038148705 8:24922693-24922715 TCTGTAAAACAGGGCTGCCGAGG + Intergenic
1039488740 8:37931776-37931798 TCTGGACACCAAGGCTTAGGGGG - Intergenic
1040917259 8:52575290-52575312 TCTGGTCAACAGGAGTCCTGTGG + Intergenic
1044010925 8:86993958-86993980 TCTGGACTACAGGGCTCTATTGG + Intronic
1050035089 9:1426657-1426679 TCTGGACAACAGAGCTACCATGG - Intergenic
1057867139 9:98690684-98690706 TTTGGACAGCAGCACTCCGGGGG - Intronic
1061953533 9:133949676-133949698 TCTCCAAAACAGGGCCCCGGAGG + Intronic
1062643856 9:137536370-137536392 TCTGGACAGCAGGCCTGGGGAGG + Intronic
1203779929 EBV:95722-95744 TCTGGACCAGAAGGCTCCGGCGG + Intergenic
1203632109 Un_KI270750v1:80080-80102 GGTGGACATCAGGGCTCAGGTGG + Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1186862890 X:13690635-13690657 TCTGGACTACAGTACTCTGGAGG + Intronic
1187311082 X:18143558-18143580 TCTGTACAACACTGCTCTGGTGG + Intergenic
1189850079 X:45169131-45169153 TCAGGACAACAGGCATCCTGTGG + Intronic
1195130504 X:101846228-101846250 TCTGGACATCTGGTCTCCGTAGG + Intronic
1199714655 X:150498133-150498155 TCTGGCCAACATGGCTCAGCAGG - Intronic