ID: 1144484728

View in Genome Browser
Species Human (GRCh38)
Location 17:15655320-15655342
Sequence ATCCTGCTTGGGTTTCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144484722_1144484728 19 Left 1144484722 17:15655278-15655300 CCTGGCCCTTTCTACAGCTTCAG 0: 1
1: 0
2: 1
3: 23
4: 273
Right 1144484728 17:15655320-15655342 ATCCTGCTTGGGTTTCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 113
1144484721_1144484728 23 Left 1144484721 17:15655274-15655296 CCTGCCTGGCCCTTTCTACAGCT 0: 1
1: 0
2: 2
3: 23
4: 305
Right 1144484728 17:15655320-15655342 ATCCTGCTTGGGTTTCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 113
1144484720_1144484728 24 Left 1144484720 17:15655273-15655295 CCCTGCCTGGCCCTTTCTACAGC 0: 1
1: 0
2: 3
3: 66
4: 514
Right 1144484728 17:15655320-15655342 ATCCTGCTTGGGTTTCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 113
1144484723_1144484728 14 Left 1144484723 17:15655283-15655305 CCCTTTCTACAGCTTCAGTAGAA 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1144484728 17:15655320-15655342 ATCCTGCTTGGGTTTCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 113
1144484724_1144484728 13 Left 1144484724 17:15655284-15655306 CCTTTCTACAGCTTCAGTAGAAA 0: 1
1: 0
2: 1
3: 17
4: 208
Right 1144484728 17:15655320-15655342 ATCCTGCTTGGGTTTCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144484728 Original CRISPR ATCCTGCTTGGGTTTCCACG TGG Intronic