ID: 1144490554

View in Genome Browser
Species Human (GRCh38)
Location 17:15704753-15704775
Sequence GGCCCTCGATGGTGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144490542_1144490554 28 Left 1144490542 17:15704702-15704724 CCAGCAGGAGTTTCATGCGGAAC 0: 3
1: 0
2: 0
3: 2
4: 37
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1144490547_1144490554 -1 Left 1144490547 17:15704731-15704753 CCAGCATATGGGGTCCCTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1144490541_1144490554 29 Left 1144490541 17:15704701-15704723 CCCAGCAGGAGTTTCATGCGGAA 0: 3
1: 0
2: 0
3: 1
4: 74
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1144490540_1144490554 30 Left 1144490540 17:15704700-15704722 CCCCAGCAGGAGTTTCATGCGGA 0: 3
1: 0
2: 0
3: 9
4: 78
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1144490546_1144490554 2 Left 1144490546 17:15704728-15704750 CCTCCAGCATATGGGGTCCCTTC 0: 1
1: 1
2: 1
3: 10
4: 119
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144490554 Original CRISPR GGCCCTCGATGGTGACCTGG AGG Intronic
900425758 1:2577909-2577931 GACCCTCGAGGGTGAAGTGGGGG + Intergenic
902882061 1:19378638-19378660 GTTACTCCATGGTGACCTGGAGG + Exonic
903258744 1:22119866-22119888 GGCCCTGGTTGGTGCCCTTGGGG + Exonic
904422685 1:30404374-30404396 GGCCCTCGCTGGTGACACTGGGG + Intergenic
906212072 1:44017551-44017573 GGCCCTGGATGGTGACCGGCAGG + Intronic
909742333 1:79045645-79045667 GGCCCAGGATGGGGACGTGGTGG + Intergenic
914678646 1:149923567-149923589 GGGCCTCGAGGGGGAACTGGTGG + Exonic
1067892774 10:50150682-50150704 GGACCACGGTGGTGACCTTGTGG - Intergenic
1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG + Intronic
1076552755 10:131294277-131294299 GGCCTTTGATGGAGACTTGGTGG - Intronic
1076761103 10:132606165-132606187 GACCCTCGATGGGGACTTGCTGG + Intronic
1081569303 11:44279622-44279644 GGCCCGAGATGGGGACTTGGGGG - Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1084510676 11:69601701-69601723 GGACCTGGATGGTGAGCTTGGGG - Intergenic
1087182804 11:95156376-95156398 GGCCATCCATGATGAGCTGGTGG - Intergenic
1091327645 11:134703129-134703151 GGCTCTGGGTGGTGTCCTGGAGG + Intergenic
1098595856 12:72272646-72272668 GGCCCTGGACGGCGAGCTGGGGG + Intronic
1103951690 12:124554885-124554907 AGCCTTCGAGGGTGACCCGGAGG + Intronic
1105413929 13:20193109-20193131 GGACCTCGAAGGGGACTTGGGGG - Intergenic
1105438857 13:20399645-20399667 GGCCCTGCATGGTGACGGGGAGG - Intergenic
1106468847 13:30037119-30037141 GGCCCTTGATGGTGGCCTTGAGG + Intergenic
1117803231 14:59465351-59465373 GGCGGTCGCTGGGGACCTGGCGG + Intronic
1118740669 14:68737238-68737260 AGCCCTGGATGGAGGCCTGGAGG - Intergenic
1120867171 14:89305204-89305226 GGTCATCGATGGTGAACTCGCGG + Intronic
1121112393 14:91321203-91321225 GCCCCTGGATGGTGCTCTGGAGG + Exonic
1122788897 14:104176229-104176251 TGCCCTGGATGGTTCCCTGGGGG + Exonic
1122824836 14:104364556-104364578 GGTCTTCCATGGTGCCCTGGAGG + Intergenic
1122933205 14:104944215-104944237 GGCCCTTGATGTCCACCTGGGGG + Exonic
1122933444 14:104945205-104945227 GGCCCTTGATGTCCACCTGGGGG + Exonic
1122934366 14:104949165-104949187 GGCCCTTGATGTCCACCTGGGGG + Exonic
1202857465 14_GL000225v1_random:59834-59856 GGCCGGCGATGGTGGCATGGAGG - Intergenic
1202863938 14_GL000225v1_random:103766-103788 GGCCCTCCATGGTGACAGGTGGG + Intergenic
1124138656 15:27057628-27057650 GAGCCCCGAGGGTGACCTGGCGG - Intronic
1132744835 16:1432261-1432283 GGCCCAGGATGGTGACTGGGTGG - Intergenic
1132763663 16:1523796-1523818 GGCCACCGGTGGGGACCTGGGGG - Intronic
1133738993 16:8637620-8637642 GGCCCTTGATGTGGACCTGCTGG + Intronic
1138424610 16:56922557-56922579 TGCCCTAGATGCTGGCCTGGAGG + Intergenic
1142315113 16:89338971-89338993 GGCCCTCGGTGGTGACTTTGAGG - Intronic
1143683139 17:8492383-8492405 GGCCCTCGAGGAAGCCCTGGAGG - Exonic
1143731359 17:8884742-8884764 GGGCATCGATGGCGACCGGGAGG - Exonic
1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG + Intronic
1144623101 17:16830869-16830891 GGCCATTACTGGTGACCTGGGGG + Intergenic
1144883330 17:18441847-18441869 GGCCATTACTGGTGACCTGGGGG - Intergenic
1145870761 17:28271329-28271351 TGAGCTTGATGGTGACCTGGAGG + Intergenic
1145996261 17:29106608-29106630 GGCCCTGGTTGGTGAACTTGTGG - Intronic
1147875154 17:43615749-43615771 GGCCCTCAAAGGAGACTTGGAGG + Intergenic
1147922269 17:43925220-43925242 TGAGCTTGATGGTGACCTGGAGG + Intergenic
1148686388 17:49503428-49503450 GGCACTCGATGCCCACCTGGAGG + Intronic
1151931499 17:77234931-77234953 GGCCCTCCCTGGTGATCTGCTGG - Intergenic
1152545234 17:80997114-80997136 GGCCCTCGAGGGTGGCCTTGTGG - Intronic
1158549638 18:58424497-58424519 GGCCCTGGAGGTTGCCCTGGAGG + Intergenic
1161154537 19:2725788-2725810 GGTCTTCCATGGTGGCCTGGGGG - Intronic
1162808298 19:13150270-13150292 GGCTCTCGATGGTGGCGTGACGG - Intronic
1165096247 19:33411414-33411436 GGCCCCCGATGGTTTCCTGTGGG - Intronic
1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG + Exonic
927156538 2:20224435-20224457 GGCCCCCGTCGGTGACCCGGGGG - Intronic
943441338 2:187931786-187931808 GGCCCTCTCTGGTGTCCAGGAGG + Intergenic
944480040 2:200147575-200147597 AGCCCTGGATGCTGACTTGGTGG - Intergenic
944728402 2:202495537-202495559 GGCCCAGGATGGGGACATGGCGG + Intronic
948384912 2:237575260-237575282 GGGACTGGATGGTGACCAGGAGG - Intronic
1172204422 20:33152791-33152813 GTCCCTTGATGGGGACCTGGAGG + Intergenic
1172211448 20:33201556-33201578 TGCTCTCGATGGAGACATGGAGG - Intergenic
1172613620 20:36268917-36268939 GCCCCTCTATGGAGGCCTGGAGG + Intronic
1175202983 20:57290745-57290767 GACCCTCGAGTGAGACCTGGAGG + Intergenic
1175401321 20:58701355-58701377 GGCTCTCCAGGGTGCCCTGGGGG + Intronic
1178382353 21:32121352-32121374 GGCACTGGATGGTGTCCTGCAGG + Intergenic
1178624559 21:34204104-34204126 GGGCCTTGAAGGTGACCTGAAGG + Intergenic
1178904644 21:36626610-36626632 GGGCCTGTGTGGTGACCTGGAGG - Intergenic
1180042811 21:45288543-45288565 GGCCCTCCAAGGAGCCCTGGAGG + Intergenic
1180869296 22:19137401-19137423 AGTCCCCGATGATGACCTGGGGG - Exonic
1181106180 22:20577131-20577153 AGCCCTCGATCCTGACTTGGTGG - Intronic
1181162506 22:20966773-20966795 GGCCCTGCAAGGTGCCCTGGGGG - Intronic
1182727407 22:32459201-32459223 GGCCCAGGAAGGTGACCTTGTGG + Intronic
1183077321 22:35435361-35435383 GGGCCTCGATGGGGACTTGGTGG + Intergenic
1185064353 22:48623328-48623350 GGCCCTGCGTGGTGACCTGTGGG + Intronic
1185320844 22:50199745-50199767 GTCCCTCCATGCTGACCTGTGGG + Intergenic
950579677 3:13854038-13854060 GCCCCAGGATGGTGTCCTGGGGG - Intronic
954083047 3:48223702-48223724 GGCCCACGATGGTGAGCTTTGGG + Exonic
954143173 3:48620907-48620929 GGCCTTCGATGTGGACCAGGAGG + Exonic
961057339 3:123800137-123800159 GGCTCTCAATGGAGTCCTGGGGG + Intronic
961361855 3:126373130-126373152 GGCCCTCCTTGGTGACCTCTGGG - Intergenic
961483281 3:127197368-127197390 GGCCCTGCAGGGTGACCGGGAGG - Exonic
961584387 3:127910219-127910241 GGCCCTCCCAGGAGACCTGGAGG + Intergenic
961645645 3:128391432-128391454 GGCCCTGGCTGGTGACCAAGTGG + Intronic
964282387 3:155080251-155080273 GGGCCCAGAGGGTGACCTGGAGG + Intronic
968085072 3:195870535-195870557 GGCCCTCCATCGTGGCCTGCGGG - Intronic
968336648 3:197919241-197919263 GGCCCTCCACGGTGACCGTGTGG + Intronic
968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG + Intergenic
968626789 4:1629438-1629460 GGGCCTCGACTGTGCCCTGGAGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968690443 4:1987297-1987319 GGTGCTGGATAGTGACCTGGGGG - Intronic
976990283 4:91356814-91356836 GGCCCTCGGGGATGACCTGCAGG + Intronic
984698183 4:182799859-182799881 TGCCCTCGATGGTGAAGTGCAGG - Exonic
987304077 5:16621518-16621540 GGCCCTGGTTGGAAACCTGGAGG + Intergenic
990910184 5:60844360-60844382 GGCCCTCGGCGGGCACCTGGCGG - Exonic
996291089 5:121852620-121852642 GGCCCCGGATGCTGGCCTGGCGG + Exonic
997412212 5:133699045-133699067 GGCAGTCAATGGTGTCCTGGAGG + Intergenic
997976693 5:138445350-138445372 AGTCCTCGATGGTGTCCAGGAGG - Exonic
998849497 5:146339766-146339788 GGGCCTCGAAGGCGACCTGCTGG + Exonic
1002466177 5:179410015-179410037 GGCCCTCGGTGGAGGCCAGGAGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1012926227 6:105270784-105270806 GGCCCTCCAGGATGAACTGGTGG - Intergenic
1017429051 6:154352710-154352732 GGGACTCCATGGTGACCTGCTGG + Intronic
1017468049 6:154713229-154713251 GGCCCTTGATGGGATCCTGGAGG + Intergenic
1017985042 6:159436271-159436293 GGCACTCAGAGGTGACCTGGAGG - Intergenic
1018987042 6:168645738-168645760 GGGCCTGCGTGGTGACCTGGGGG - Intronic
1019495820 7:1340179-1340201 GGCCCTGGGTGGGGACCTGCTGG - Intergenic
1019527634 7:1487833-1487855 GGCCTTCGAGGGGCACCTGGCGG - Exonic
1023029347 7:36079151-36079173 GGTCCTCAAAGGTGACCTGCAGG + Exonic
1034732315 7:153398910-153398932 GGCCCTCTAGGGTGGCCAGGTGG - Intergenic
1035745985 8:1962389-1962411 AGCCCACGATGCTGAGCTGGGGG - Intergenic
1037828598 8:22175057-22175079 GGCATTGGAGGGTGACCTGGTGG + Intronic
1039593600 8:38770820-38770842 GGCCCTTGATGGTGTTGTGGAGG + Intronic
1040533915 8:48289381-48289403 TGCTCTGGCTGGTGACCTGGTGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1049417905 8:142503925-142503947 GGCCCTGGATGTGGACCTGTCGG + Intronic
1050430954 9:5560903-5560925 GGGGCTCGAGGGTGACCTGCTGG + Intronic
1052134862 9:24897498-24897520 GGCCCTGGATGGAGGCGTGGTGG - Intergenic
1052892671 9:33718972-33718994 GGCCATGGATGGTGAACTGTGGG - Intergenic
1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG + Intronic
1057346938 9:94259594-94259616 GGCCCAGTATGTTGACCTGGAGG + Intronic
1062422486 9:136489846-136489868 GGCCTGCGATGGTGAGCTGCTGG - Intergenic
1203740381 Un_GL000216v2:172250-172272 GGCCCTCCATGGTGACAGGTGGG - Intergenic
1200419989 Y:2954848-2954870 GGCCCTGGATGATGAACTGTAGG - Intronic
1200685531 Y:6255029-6255051 GGCCCTGGCTGATGATCTGGTGG + Intergenic
1200687920 Y:6273638-6273660 GGCCCTGGCTGATGATCTGGGGG + Intergenic
1200831756 Y:7692633-7692655 GGCCCTGGCTGATGATCTGGGGG - Intergenic
1200979427 Y:9248317-9248339 GGCCCTGGCTGATGATCTGGGGG + Intergenic
1200991061 Y:9346270-9346292 GGCCCTGGCTGATGATCTGGTGG + Intergenic
1200993719 Y:9366563-9366585 GGCCCTGGCTGATGATCTGGTGG + Intronic
1200996382 Y:9386881-9386903 GGCCCTGGCTGATGATCTGGTGG + Intergenic
1200998897 Y:9455436-9455458 GGCCCTGGCTGATGATCTGGTGG + Intergenic
1201001551 Y:9475745-9475767 GGCCCTGGCTGATGATCTGGTGG + Intronic
1201004217 Y:9496047-9496069 GGCCCTGGCTGATGATCTGGTGG + Intergenic
1201006872 Y:9516359-9516381 GGCCCTGGCTGATGATCTGGTGG + Intergenic
1201009524 Y:9536665-9536687 GGCCCTGGCTGATGATCTGGTGG + Intergenic
1201012115 Y:9557367-9557389 GGCCCTGGCTGATGATCTGGTGG + Intergenic
1201047347 Y:9901064-9901086 GGCCCTGGCTGATGATCTGGGGG - Intergenic
1201062407 Y:10059204-10059226 GGCCCTGGCTGATGATCTGGGGG - Intergenic
1202111585 Y:21427197-21427219 GGCCCTGGCTGATGATCTGGGGG - Intergenic
1202116859 Y:21476940-21476962 GGCCCTGGCTGATGATCTGGGGG + Intergenic
1202131961 Y:21620972-21620994 GGCCCTGGCTGATGATCTGGGGG - Intergenic
1202161744 Y:21941511-21941533 GGCCCTGGCTGATGATCTGGGGG - Intergenic
1202195578 Y:22296177-22296199 GGCCCTGAATGATGATCTGGGGG - Intergenic
1202229612 Y:22644862-22644884 GGCCCTGGCTGATGATCTGGGGG + Intergenic
1202232446 Y:22670677-22670699 GGCCCTGAATGATGATCTGGGGG + Intergenic
1202310710 Y:23525481-23525503 GGCCCTGAATGATGATCTGGGGG - Intergenic
1202313544 Y:23551303-23551325 GGCCCTGGCTGATGATCTGGGGG - Intergenic
1202557259 Y:26119292-26119314 GGCCCTGGCTGATGATCTGGGGG + Intergenic
1202560092 Y:26145113-26145135 GGCCCTGAATGATGATCTGGGGG + Intergenic