ID: 1144490554

View in Genome Browser
Species Human (GRCh38)
Location 17:15704753-15704775
Sequence GGCCCTCGATGGTGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144490546_1144490554 2 Left 1144490546 17:15704728-15704750 CCTCCAGCATATGGGGTCCCTTC 0: 1
1: 1
2: 1
3: 10
4: 119
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1144490547_1144490554 -1 Left 1144490547 17:15704731-15704753 CCAGCATATGGGGTCCCTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1144490540_1144490554 30 Left 1144490540 17:15704700-15704722 CCCCAGCAGGAGTTTCATGCGGA 0: 3
1: 0
2: 0
3: 9
4: 78
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1144490542_1144490554 28 Left 1144490542 17:15704702-15704724 CCAGCAGGAGTTTCATGCGGAAC 0: 3
1: 0
2: 0
3: 2
4: 37
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1144490541_1144490554 29 Left 1144490541 17:15704701-15704723 CCCAGCAGGAGTTTCATGCGGAA 0: 3
1: 0
2: 0
3: 1
4: 74
Right 1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144490554 Original CRISPR GGCCCTCGATGGTGACCTGG AGG Intronic