ID: 1144492448

View in Genome Browser
Species Human (GRCh38)
Location 17:15725389-15725411
Sequence TTGGCCACAGGCGGGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144492448_1144492456 9 Left 1144492448 17:15725389-15725411 CCCAGATGCCCGCCTGTGGCCAA No data
Right 1144492456 17:15725421-15725443 CAAGTCTTTCTAAAGATAGCAGG No data
1144492448_1144492457 14 Left 1144492448 17:15725389-15725411 CCCAGATGCCCGCCTGTGGCCAA No data
Right 1144492457 17:15725426-15725448 CTTTCTAAAGATAGCAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144492448 Original CRISPR TTGGCCACAGGCGGGCATCT GGG (reversed) Intergenic
No off target data available for this crispr