ID: 1144495240

View in Genome Browser
Species Human (GRCh38)
Location 17:15741601-15741623
Sequence ATGGGCAGACACTTCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144495240 Original CRISPR ATGGGCAGACACTTCCATCT TGG (reversed) Intronic
900395589 1:2452019-2452041 CTGAGCAGAGACTTCCGTCTGGG + Intronic
901646970 1:10722076-10722098 CTGGGCAGACACCTGCGTCTTGG + Intronic
903150552 1:21405054-21405076 ATGGGCATGCAATTCCAGCTTGG - Intergenic
904369847 1:30041605-30041627 ATGGGCAGACACTACCACTCAGG + Intergenic
905443901 1:38012415-38012437 ATGTGCAGTCACTTACAGCTCGG - Intronic
905880425 1:41459782-41459804 ATGGGCAGAAGCCCCCATCTGGG - Intergenic
907267922 1:53274112-53274134 CAGGGCAGCCACTTCCATCCAGG + Intronic
913386216 1:118260779-118260801 ATCTGCTGACACTTCGATCTTGG + Intergenic
916272478 1:162958076-162958098 GTGGGCAGAGACTTCCATGATGG + Intergenic
917682058 1:177377409-177377431 ATGTGCAGCCATTTCTATCTTGG + Intergenic
918180693 1:182084244-182084266 CTATGCAGACACTTCCCTCTGGG + Intergenic
922450808 1:225735741-225735763 AGGGGCAGGCACCTACATCTGGG + Intergenic
922644800 1:227275994-227276016 CTGGGCAGAGGCTGCCATCTCGG - Intronic
923058126 1:230444184-230444206 ATGGGCAGACATTTCATTGTAGG - Intergenic
1064970361 10:21059871-21059893 ATGGCCAGACACTCCAAACTGGG + Intronic
1069828228 10:71267240-71267262 CTGGGCAGCCACTTCCCTCTGGG - Intronic
1071938708 10:90561941-90561963 ATGGCCTGACACTTGCAACTAGG + Intergenic
1074828184 10:117229540-117229562 ATGGGCATACATTTACAACTGGG + Intergenic
1075343266 10:121663915-121663937 ATGGGCTGACACCTTGATCTTGG - Intergenic
1078450552 11:11437646-11437668 ATAGCCAGACACCTCCGTCTTGG + Intronic
1080624149 11:34013442-34013464 AAGGGAAGACACTGCCATCATGG - Intergenic
1081604492 11:44518903-44518925 CTGGGCAGAGTCTTCCATCTTGG - Intergenic
1082980159 11:59113821-59113843 ATTGGAAAACACTTCCCTCTAGG - Intronic
1087956048 11:104289243-104289265 ATGTTCAGACACTTCCCTATGGG - Intergenic
1099388085 12:82042881-82042903 ATGGCCATAAACTTCCTTCTTGG - Intergenic
1099680767 12:85824979-85825001 ATGAGCACACATTTCCATTTCGG - Intronic
1102945407 12:116983055-116983077 CTGGGCATTCACTTCCATCTTGG - Intronic
1109128350 13:58547361-58547383 AGGGGAAGACACACCCATCTTGG - Intergenic
1112682069 13:101778177-101778199 ATAGGCAGACAGTTCCAACTGGG - Intronic
1114151449 14:20044460-20044482 CTGTACAGACACTTACATCTTGG + Intergenic
1121411390 14:93750842-93750864 ATGCCCAGAGACTTCCACCTAGG - Intronic
1122278348 14:100606927-100606949 ATGCCCAGACACTCCCCTCTTGG + Intergenic
1122820376 14:104341693-104341715 ATTTGCTGACACCTCCATCTTGG - Intergenic
1122933087 14:104943676-104943698 AGGGGCTGTCACTTCCACCTTGG + Exonic
1122934240 14:104948626-104948648 AGGGGCTGTCACTTCCACCTTGG + Exonic
1122934825 14:104951101-104951123 AGGGGCTGTCACTTCCACCTTGG + Exonic
1132731231 16:1362989-1363011 TTTGGCAGAAACTTCCAACTTGG + Exonic
1137744876 16:50813156-50813178 ATGGGCAGTCTCTTCCCTCCAGG + Intergenic
1138027956 16:53537672-53537694 ATGAGCAAACACATTCATCTGGG - Intergenic
1140653166 16:77110630-77110652 ATCAGCAGACACTGCCATATTGG + Intergenic
1141052812 16:80787373-80787395 AAGGGCAGTCTCTTCCATTTTGG - Intronic
1141938216 16:87255959-87255981 ATGCGCAGACACCCCAATCTCGG + Intronic
1143645274 17:8225946-8225968 GTGGGCAGCCCCTTCCATCGAGG + Intergenic
1144413913 17:15027769-15027791 ATGGGCACACACATACTTCTGGG + Intergenic
1144476765 17:15595479-15595501 TGGGGCAGACACTACCTTCTTGG + Intronic
1144495240 17:15741601-15741623 ATGGGCAGACACTTCCATCTTGG - Intronic
1144638992 17:16927296-16927318 ATGGGCAGACATTGCCATCTTGG + Intergenic
1145760887 17:27425123-27425145 ATGGGGAGATGCTGCCATCTGGG - Intergenic
1145833528 17:27936703-27936725 ATGGGGAGTCACTTCCTGCTAGG - Intergenic
1146160929 17:30559280-30559302 ATGGGGAGATGCTGCCATCTGGG - Exonic
1148221609 17:45866370-45866392 ATGGGCTCACACTTCTCTCTAGG + Intergenic
1151578515 17:74964572-74964594 CTGGGCAGACACAGCCACCTCGG - Exonic
1153221822 18:2868402-2868424 CTGGGCAGAGACTGCAATCTCGG + Intronic
1159580575 18:70230682-70230704 ATTGGCTGGCACTTTCATCTTGG - Intergenic
1163134401 19:15299118-15299140 ATAGGCAGTGTCTTCCATCTGGG + Intronic
1164901841 19:31934148-31934170 GGGGGCAGAAACTTCCTTCTTGG + Intergenic
1165434478 19:35788597-35788619 ATGGGCAGACCCTTCAGTCCAGG - Exonic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
930860279 2:56064990-56065012 ATGGGGAGACACCTCCAGCAGGG - Intergenic
931214843 2:60231598-60231620 ATTGGCAGAATTTTCCATCTTGG - Intergenic
932707545 2:74038356-74038378 ATGGGAACACACCTCCAACTTGG + Intronic
933494692 2:83034331-83034353 ATGGTCAGACACTACCCACTTGG - Intergenic
934529451 2:95075939-95075961 TTGGGCAGATACTTCCAGCAGGG + Intergenic
939185117 2:138851655-138851677 ATGGACCTACTCTTCCATCTAGG + Intergenic
940600711 2:155855813-155855835 CTGGGTAAACACTTCCATTTTGG + Intergenic
940973689 2:159921024-159921046 GGAGGCAGACACTTCCAGCTGGG - Intergenic
945230843 2:207587831-207587853 ATGGACACAAACTTACATCTAGG + Intronic
947500826 2:230669531-230669553 ATGGGAAGGCTCTTACATCTAGG - Intergenic
948544792 2:238719810-238719832 ATGGACAGACACATCCACATGGG + Intergenic
1168903599 20:1386676-1386698 AGGGGCAGAGACCTCCATGTGGG + Intronic
1170157748 20:13284175-13284197 ATCGGTAGACACTGTCATCTAGG + Intronic
1173249431 20:41356865-41356887 ATGCACAGACACATCCATGTGGG - Intronic
1181633354 22:24162957-24162979 ATGGGCAGACACTGTCTCCTGGG - Intronic
1182843591 22:33412375-33412397 ATGGGAAAACACTACCATCAGGG - Intronic
1184271808 22:43388704-43388726 AGGGGCTGTCACTTCCACCTGGG - Intergenic
951105764 3:18740525-18740547 ATGTGCACACAATTCCATCATGG + Intergenic
952169899 3:30795491-30795513 ATTGGCAGACACTACAAACTGGG + Intronic
955393042 3:58535132-58535154 ATGGAGAGACACTTCCAACCCGG + Exonic
958000835 3:87746848-87746870 CTGGTCAGACATTTCCATCTAGG - Intergenic
960250927 3:115452325-115452347 CTGGGCAGAGAGTTACATCTTGG - Intergenic
962019496 3:131482836-131482858 ATGGAGAGACACTTCCTGCTAGG - Intronic
962334766 3:134517254-134517276 ATACGCAGACATTTTCATCTTGG - Intronic
963727149 3:148935272-148935294 AAGGTCAGACACTTCCGTTTGGG - Intergenic
965779697 3:172271866-172271888 AAGGATAGACACTGCCATCTTGG + Intronic
966881339 3:184352921-184352943 GTGGGCAGCCTCTTCCAGCTGGG + Intronic
967419495 3:189258442-189258464 ATGGGGAGACACGTCCAGCAGGG - Intronic
967511690 3:190320770-190320792 GTGGGCAGTCACGTTCATCTAGG + Intronic
968601999 4:1513828-1513850 GTGGCCATACTCTTCCATCTTGG + Intergenic
969953369 4:10863622-10863644 ATGTGCAGATACTTCTCTCTTGG + Intergenic
970869112 4:20794130-20794152 ATGGGCTCACACTTCCACATGGG - Intronic
971305907 4:25481317-25481339 ATTGGCAGGCACTTTGATCTTGG - Intergenic
971735125 4:30439427-30439449 ATGGTCAGACATTTCCTTCTTGG + Intergenic
972388240 4:38588298-38588320 ATGTGCAGACACTTGCATAATGG + Intergenic
973966259 4:56165028-56165050 ATGGCCAGAAACTGCCATCTGGG - Intergenic
975265797 4:72365248-72365270 ATGAGCAGACATTTCCAGCATGG + Intronic
981423074 4:144573190-144573212 ATTCGCAGACATTTTCATCTAGG - Intergenic
984528811 4:180890223-180890245 ATCTGCAGACACCTCGATCTTGG - Intergenic
984583178 4:181533838-181533860 ATTGGCATAAACTCCCATCTTGG + Intergenic
985912119 5:2892790-2892812 AGGGCCAGACAGATCCATCTGGG - Intergenic
989122761 5:38020706-38020728 ATGGCAAGACACGTCCTTCTGGG + Intergenic
990501184 5:56398259-56398281 ATGGGCAGAGGCTACAATCTCGG + Intergenic
994791310 5:104229779-104229801 ATATGCAAACACTTCCATCAAGG + Intergenic
997829836 5:137140305-137140327 ATGAGCAGAAAATTCCTTCTTGG - Intronic
1001307405 5:170585533-170585555 ATGGGCAGAAACTGCCATGCTGG - Intronic
1001479504 5:172078181-172078203 ATGGCAAGACAGTGCCATCTGGG + Intronic
1001511382 5:172325058-172325080 ATGGGCACACAGTTTCATTTTGG + Intergenic
1003221294 6:4163231-4163253 ATGGCCACATGCTTCCATCTGGG - Intergenic
1003704224 6:8506479-8506501 ATGGCCAAACAATTCCTTCTTGG - Intergenic
1006473399 6:34240585-34240607 GTGGGCAGACCCCTCCATCCTGG + Intronic
1007090608 6:39182293-39182315 ATGGGCAAACACTACCAATTAGG - Intergenic
1008636514 6:53416370-53416392 ATTGGCATACACTTTCATCTTGG + Intergenic
1016128900 6:140441465-140441487 ATGAGCATACAGCTCCATCTGGG + Intergenic
1017238363 6:152140694-152140716 ATGGGCAAACACTACCATGATGG + Intronic
1017281465 6:152630443-152630465 ATGGGCACACAATTCCAGCAGGG - Intronic
1017512097 6:155123605-155123627 TGGGGCAGAAACTTCCACCTGGG + Intronic
1018962926 6:168461092-168461114 ATGGGCTTACAGTTCCATGTGGG + Intronic
1035855449 8:2971256-2971278 AGGGTCAGACTCTACCATCTCGG + Intronic
1037567049 8:20126870-20126892 ATGGGCAGAAACTGCCACCATGG - Intergenic
1044259507 8:90101346-90101368 ATTGGGAGAAAATTCCATCTAGG - Intergenic
1044772803 8:95655023-95655045 ATGGGCAGTAAATTCCATTTTGG - Intergenic
1049101005 8:140578862-140578884 CGGGGCAGACACTTGCTTCTCGG - Intronic
1051028074 9:12638150-12638172 ATGGGCAGACACAGGAATCTAGG - Intergenic
1051762919 9:20488231-20488253 ATAGGTAGAAACTTCCAGCTTGG + Intronic
1053203670 9:36169190-36169212 ATGGGCGGCAACTTCCACCTGGG - Intergenic
1058417885 9:104806805-104806827 ATGGGCATACACCTCCATGAAGG - Intronic
1059809833 9:117843851-117843873 ATGGGGAGTCACTGCTATCTGGG + Intergenic
1061398562 9:130356234-130356256 ATGCACAGACACCTCCACCTCGG - Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1061862768 9:133476394-133476416 AGGGGCTGACTCTCCCATCTCGG - Intronic
1185498042 X:572710-572732 GTGGGCAGACAGTTCCATGATGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1186737959 X:12486067-12486089 ATGGGTACCAACTTCCATCTTGG + Intronic
1188086327 X:25905648-25905670 ATGGGCAGAGGCTGCAATCTCGG - Intergenic
1188451917 X:30316397-30316419 GTGGGTAGACAGTTCCATGTGGG - Intergenic
1192405309 X:70879424-70879446 TTGGGCAAATACTTCCATTTTGG - Intronic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1196199385 X:112868336-112868358 ATGGGTATAGACTTCTATCTAGG - Intergenic
1197838678 X:130722197-130722219 AATGGCAGACACCTCCATCCTGG - Intronic
1198999642 X:142619497-142619519 ATTGGAAGACAATGCCATCTAGG - Intergenic