ID: 1144501076

View in Genome Browser
Species Human (GRCh38)
Location 17:15786897-15786919
Sequence AGCAGACGTCGCCGCCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144501076_1144501080 -2 Left 1144501076 17:15786897-15786919 CCCCCGCGGCGGCGACGTCTGCT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501076_1144501083 22 Left 1144501076 17:15786897-15786919 CCCCCGCGGCGGCGACGTCTGCT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144501076 Original CRISPR AGCAGACGTCGCCGCCGCGG GGG (reversed) Intergenic