ID: 1144501078

View in Genome Browser
Species Human (GRCh38)
Location 17:15786899-15786921
Sequence GGAGCAGACGTCGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144501078_1144501080 -4 Left 1144501078 17:15786899-15786921 CCCGCGGCGGCGACGTCTGCTCC No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501078_1144501083 20 Left 1144501078 17:15786899-15786921 CCCGCGGCGGCGACGTCTGCTCC No data
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144501078 Original CRISPR GGAGCAGACGTCGCCGCCGC GGG (reversed) Intergenic
No off target data available for this crispr