ID: 1144501079

View in Genome Browser
Species Human (GRCh38)
Location 17:15786900-15786922
Sequence AGGAGCAGACGTCGCCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144501079_1144501080 -5 Left 1144501079 17:15786900-15786922 CCGCGGCGGCGACGTCTGCTCCT No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501079_1144501083 19 Left 1144501079 17:15786900-15786922 CCGCGGCGGCGACGTCTGCTCCT No data
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144501079 Original CRISPR AGGAGCAGACGTCGCCGCCG CGG (reversed) Intergenic