ID: 1144501080

View in Genome Browser
Species Human (GRCh38)
Location 17:15786918-15786940
Sequence CTCCTCTGATTCCTTCAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 3, 1: 0, 2: 1, 3: 8, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144501079_1144501080 -5 Left 1144501079 17:15786900-15786922 CCGCGGCGGCGACGTCTGCTCCT No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501069_1144501080 29 Left 1144501069 17:15786866-15786888 CCGTGATGGGGCCGGAGCTGGGC No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501073_1144501080 18 Left 1144501073 17:15786877-15786899 CCGGAGCTGGGCTGGGGACACCC No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501076_1144501080 -2 Left 1144501076 17:15786897-15786919 CCCCCGCGGCGGCGACGTCTGCT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501078_1144501080 -4 Left 1144501078 17:15786899-15786921 CCCGCGGCGGCGACGTCTGCTCC No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501077_1144501080 -3 Left 1144501077 17:15786898-15786920 CCCCGCGGCGGCGACGTCTGCTC No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501067_1144501080 30 Left 1144501067 17:15786865-15786887 CCCGTGATGGGGCCGGAGCTGGG No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144501080 Original CRISPR CTCCTCTGATTCCTTCAACG AGG Intergenic