ID: 1144501080

View in Genome Browser
Species Human (GRCh38)
Location 17:15786918-15786940
Sequence CTCCTCTGATTCCTTCAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 3, 1: 0, 2: 1, 3: 8, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144501078_1144501080 -4 Left 1144501078 17:15786899-15786921 CCCGCGGCGGCGACGTCTGCTCC No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501077_1144501080 -3 Left 1144501077 17:15786898-15786920 CCCCGCGGCGGCGACGTCTGCTC No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501067_1144501080 30 Left 1144501067 17:15786865-15786887 CCCGTGATGGGGCCGGAGCTGGG No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501076_1144501080 -2 Left 1144501076 17:15786897-15786919 CCCCCGCGGCGGCGACGTCTGCT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501069_1144501080 29 Left 1144501069 17:15786866-15786888 CCGTGATGGGGCCGGAGCTGGGC No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501079_1144501080 -5 Left 1144501079 17:15786900-15786922 CCGCGGCGGCGACGTCTGCTCCT No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118
1144501073_1144501080 18 Left 1144501073 17:15786877-15786899 CCGGAGCTGGGCTGGGGACACCC No data
Right 1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG 0: 3
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144501080 Original CRISPR CTCCTCTGATTCCTTCAACG AGG Intergenic
900796305 1:4710797-4710819 CTCCTCTGAGCCCTTCCACGTGG + Intronic
901473331 1:9472696-9472718 CTGCTCTGCTTCCTGCACCGGGG - Intergenic
902399739 1:16151348-16151370 CCCCTCTGCTTCCTTGAACAAGG + Intronic
904631983 1:31849212-31849234 GACCAATGATTCCTTCAACGAGG - Intergenic
905171716 1:36113693-36113715 CTCCTCTCCTGCCTTCAACCTGG - Intronic
906515716 1:46437745-46437767 CTCCTATAATTCCTTCAGCTTGG + Intergenic
906847123 1:49205241-49205263 CTCCTCTGTGTCCTTGAAAGAGG - Intronic
907249045 1:53125787-53125809 CTGCTCTGGTTCCCTCCACGGGG - Intronic
907952156 1:59194087-59194109 AGCCTCTGACTCCTTCAAAGCGG - Intergenic
913099266 1:115548011-115548033 CTCCTCTGATTGCACCAAGGAGG - Intergenic
914799009 1:150946354-150946376 CTCCTGTAATTCCTTAAACAAGG + Intronic
919766247 1:201129124-201129146 CTCCTCTGATTCCTGCCTCCAGG - Intergenic
921156517 1:212443194-212443216 CTTCTCTCATTGCTTCAACTAGG - Intronic
922502061 1:226104597-226104619 CTCTTCTGATTGCTTCAATTTGG - Intergenic
1063869514 10:10402701-10402723 TTCCCCTGATTCTTTCAACTGGG - Intergenic
1064068086 10:12200805-12200827 CACCTCTGATTCCTACTACTCGG + Intronic
1064556174 10:16549493-16549515 CTCCTTTTACTCCTTCAATGTGG - Intergenic
1064827048 10:19416265-19416287 CTTCTCTGATTCTCTCAACTGGG - Intronic
1066216147 10:33289737-33289759 CTCCTCTATTTCCTTCAATTAGG + Intronic
1068618547 10:59150624-59150646 CTCCTATGTTTCCTTCAAGAAGG + Intergenic
1070327969 10:75400266-75400288 CTCCTCGGTTGCCTCCAACGGGG - Exonic
1073888510 10:108069375-108069397 CTCCTCTGATTGGTTCAAACTGG - Intergenic
1076736244 10:132460437-132460459 CTTCTCTGCTGCCTTCCACGTGG + Intergenic
1076751797 10:132547012-132547034 CTCCTCTGGTTCCTGGAATGAGG - Intronic
1078951015 11:16134333-16134355 CTACTCTCACTCCTACAACGTGG - Intronic
1085740847 11:79077181-79077203 GTCCTCTGATGCCTCCAACAAGG - Intronic
1088439400 11:109852299-109852321 CTCCTCTAATTTCTACAATGGGG + Intergenic
1088980259 11:114856563-114856585 CAGCCCTGATTCCTTCAACTTGG + Intergenic
1089282121 11:117381796-117381818 CTCCTCTGCCTCCTTCCACTCGG - Exonic
1094196291 12:27753271-27753293 CTCCTTTGAATCCTTCAAACTGG - Intronic
1104297279 12:127528268-127528290 CTACTCTGACTCCTTTAAAGTGG - Intergenic
1105628900 13:22141525-22141547 CTCATCTGAGTCCGTCAATGTGG - Intergenic
1107600815 13:42010635-42010657 CTCCTGTTATTCCTTCAGCTTGG + Intergenic
1107816845 13:44252095-44252117 CACTTCTGATTCCTCCAAGGAGG + Intergenic
1112357350 13:98684913-98684935 CAACTCTGATTTCTTCAAAGTGG - Exonic
1113380361 13:109798344-109798366 CTCCTCTGACTCCTTCACAAAGG - Intergenic
1120530695 14:85627355-85627377 CTTCTCTGATTTCTTCAGCAGGG + Exonic
1124365198 15:29066105-29066127 CCCCTCTGATTCATTCATTGCGG + Intronic
1125200255 15:37096312-37096334 CTCCTCCGACTCCTTCAACGAGG - Exonic
1126930062 15:53637917-53637939 CATGTCTGATTCCTTCAATGGGG + Intronic
1130437819 15:83919614-83919636 CTCCTCTGTTTTCTTTAACATGG - Intronic
1130508960 15:84572581-84572603 GTCCCCTGATTCCTGCAACTGGG + Intergenic
1131780045 15:95846200-95846222 CTCCTCTGTTCCCTTCAAGTTGG - Intergenic
1133011536 16:2914822-2914844 CTCCGCTGAATCCTTGAACCAGG - Intronic
1134320710 16:13160158-13160180 CACCTGTGATTCCTTCCACCTGG - Intronic
1141517773 16:84557758-84557780 CTCCTCAGATGCCTTCCACCTGG - Intergenic
1142696806 17:1638507-1638529 CTCCTCGGAAGCCTTCAATGAGG - Intronic
1142850440 17:2701968-2701990 CCCATCCGATGCCTTCAACGGGG - Exonic
1143125184 17:4637310-4637332 CTACTCGGATTCCTCCAAGGGGG + Intronic
1144501080 17:15786918-15786940 CTCCTCTGATTCCTTCAACGAGG + Intergenic
1145005384 17:19334494-19334516 CTCCTCTGAGGCCTTGGACGAGG + Exonic
1145163247 17:20589592-20589614 CTCCTCTGATTCCTTCAACGAGG + Intergenic
1147968610 17:44207477-44207499 CTCCTCTGAGTCCAGCAGCGAGG - Exonic
1149199722 17:54169314-54169336 CTCTTCTGATTCTTTCAAGAAGG + Intergenic
1150488076 17:65557922-65557944 CTCCTCTTCTTCATTCAAGGTGG + Exonic
1150882649 17:69047955-69047977 GTCTCCTGATTCCTGCAACGTGG + Intronic
1160774938 19:851042-851064 CTCGTCTGTTGCCTCCAACGGGG - Intronic
1161507288 19:4650709-4650731 CTCCGATGATTCCTCCAACAGGG - Intronic
1165717450 19:38055617-38055639 CTCTTCTGATTCCTTGAGAGAGG - Intronic
1165976885 19:39683815-39683837 TTCCTCTCATTCCTCCAAGGAGG - Intergenic
1167103241 19:47416827-47416849 CTCCTCTGATTCCTTCAACGAGG - Exonic
1168124953 19:54277939-54277961 CTCCTCTCATTCTTTCACCCAGG - Exonic
925730504 2:6917186-6917208 CTCCCCTGATTCCTACACCGAGG - Intergenic
925748775 2:7068539-7068561 CTCCTCTGATGTCCTCAACCTGG - Intergenic
930679836 2:54245188-54245210 ATCCTGTGATTCCTGCAACATGG - Intronic
932687228 2:73882203-73882225 CTTCTCTGATGCCTTCAAACAGG + Intergenic
941613206 2:167686882-167686904 CTCTGCTGATTCCTGTAACGCGG + Intergenic
948190579 2:236055147-236055169 CTCCTCTGATTCTATCATCCCGG + Intronic
948222120 2:236278876-236278898 CTCCTCTGATTATTTCTACCTGG - Intergenic
1170079451 20:12455840-12455862 CTCCTCTGGTTCCTCCAAAGTGG - Intergenic
1175565894 20:59976785-59976807 TTCCTCTGCTTCCATCACCGTGG - Intronic
1179130388 21:38631161-38631183 CTCTTCCAATTCCTTCAACTCGG + Intronic
1182952700 22:34392139-34392161 GTCCCCTGATTCCTTCAAGCAGG + Intergenic
952005245 3:28835956-28835978 CTCATCTGATTCCTTCAGCCAGG - Intergenic
954697512 3:52435588-52435610 CTCCTCTGCCCCCTTCTACGTGG + Exonic
955125500 3:56106936-56106958 CACCTCTGATTGATTCACCGTGG - Intronic
955484508 3:59422329-59422351 CTCCTCTGATTTCTTTAAATGGG + Intergenic
956344907 3:68267823-68267845 CTCCTCTTATTTCTTCAAATAGG + Intronic
965113015 3:164451385-164451407 TTCCTCTGATTCCTCCAAGATGG - Intergenic
969863816 4:10058970-10058992 CTCCTCAGTTTCCTGCTACGTGG - Intergenic
972146551 4:36034304-36034326 CTTCTCTGATTCCTTTAAGCAGG + Intronic
979751425 4:124284274-124284296 CTCTTCTTATTCCTTCAGAGGGG - Intergenic
987915136 5:24203042-24203064 CTCTTCTAATTCATTCAATGAGG + Intergenic
988734634 5:34008034-34008056 CTGCTCAGTTTCCTTCAGCGGGG - Intronic
994090999 5:95809467-95809489 CTTCTCTGCTTCCTCCAACCTGG - Intronic
995703394 5:114960167-114960189 CTCCTCAAATCCCTTCAACCTGG + Intergenic
1004889334 6:20084234-20084256 CTCCTCAGTCTCCTTCAACCTGG + Intergenic
1009630404 6:66191742-66191764 CTCCTCCGATTCCTTCACGGAGG + Intergenic
1012299182 6:97563401-97563423 CTCCCCTGCTACCTCCAACGGGG - Intergenic
1013051681 6:106542074-106542096 ATCCTCTGGTTCCTTCTATGTGG + Intronic
1017916439 6:158835433-158835455 CTCTTCTGATTCCTTCTCCAAGG + Intergenic
1024929369 7:54653926-54653948 TTCCTGTGATTTCTTCAAAGTGG + Intergenic
1026130522 7:67616885-67616907 CTCCTCTGATTCTTCCCATGGGG - Intergenic
1027862092 7:83597172-83597194 CTCCTCTGATACCAACAATGTGG + Intronic
1027862569 7:83603432-83603454 CTCCTCTCATCCCTTCTACCTGG - Intronic
1033108766 7:138556755-138556777 GTCCTCTGATTCCTGCAACAAGG - Intronic
1035641883 8:1190298-1190320 CTCCTCTGTTGCCTTTCACGTGG + Intergenic
1036585383 8:10118762-10118784 CTCCTCTGTTACCTCCAATGTGG + Intronic
1038731074 8:30128295-30128317 CTCCTCTGATTGGTTAAACCAGG - Intronic
1039745093 8:40418318-40418340 CTCCTCAGATTCCTCCCTCGGGG + Intergenic
1046327808 8:112672859-112672881 CACTTCTGATTCTTTCATCGAGG - Intronic
1046558825 8:115812535-115812557 CTCCTCTATTTCTTTCAATGGGG + Intergenic
1048192814 8:132305734-132305756 CTCCTCTTGTCCCTTCAACTTGG + Intronic
1048230065 8:132629972-132629994 TTCTTCTGAGTCCTTCAATGAGG - Intronic
1048455444 8:134574117-134574139 CCCCTCTCCTTCCTTCAACGTGG - Intronic
1049233633 8:141496978-141497000 CTCCTCTCCTTCCTCCAAGGTGG + Intergenic
1049233682 8:141497194-141497216 CTCCTCTCCTTCCTCCAAGGTGG + Intergenic
1049874629 8:145008323-145008345 CTCCTCTGATTCCTCCCTTGGGG + Intergenic
1051262057 9:15274080-15274102 CTCATATGATTCCTTTAACTAGG - Intronic
1051665940 9:19466989-19467011 CTACTCTGCTTCCTGGAACGTGG + Intergenic
1051911849 9:22161866-22161888 CTCCTCTAATTCCTTTTCCGTGG - Intergenic
1052344088 9:27390699-27390721 ACCCTCTGATTCCTTCAACTGGG - Intronic
1052992117 9:34524566-34524588 CTCCTCTGTTTCCTATAACTAGG - Intergenic
1055219226 9:73908174-73908196 TTCCTGTGGTTCCTTCAACATGG - Intergenic
1055928552 9:81536080-81536102 CTCCTATCATTCCATCAACAAGG - Intergenic
1057273598 9:93664533-93664555 CTCCTCTCATCTCTTCAATGAGG - Intronic
1059459395 9:114420306-114420328 CTCGCCTGTTTCCTTCAAGGAGG - Intronic
1061860008 9:133463208-133463230 CTCCTCTGAGCCCTGAAACGGGG + Intronic
1202630860 M:15223-15245 CTCCTCAGATTCATTGAACTAGG - Intergenic
1190311862 X:49122576-49122598 TTCCTCTTCTTCCTTCAATGGGG + Intronic
1190437584 X:50441256-50441278 CACCTCTGAGTCCTTGAATGAGG - Intronic
1192355432 X:70398426-70398448 CACCTCTAATTCCTTCTACTTGG - Intronic
1192682072 X:73262778-73262800 CTCCTCTGTTTCCCTCCACCTGG - Intergenic
1194076645 X:89402250-89402272 CTCCTTTCATTTCTTCAAAGAGG + Intergenic
1194751954 X:97694779-97694801 CTCTGCTGATACCTTGAACGTGG + Intergenic
1196285460 X:113873668-113873690 CTCCTCAGTTTCCTTCTATGGGG - Intergenic
1197769291 X:130079871-130079893 CTTGTCTGATGCCTTCCACGAGG + Intronic
1198760718 X:140029714-140029736 CTCCTGTGATTCCTACATCCAGG + Intergenic
1200429287 Y:3057773-3057795 CTCCTTTCATTTCTTCAAAGAGG + Intergenic
1201972707 Y:19814724-19814746 CTCCTCTGTTTCCCTCCACCTGG - Intergenic