ID: 1144501081

View in Genome Browser
Species Human (GRCh38)
Location 17:15786920-15786942
Sequence GTCCTCGTTGAAGGAATCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144501081_1144501086 13 Left 1144501081 17:15786920-15786942 CCTCTGATTCCTTCAACGAGGAC No data
Right 1144501086 17:15786956-15786978 CCAAGCAGGTTCGCTCTGAGAGG No data
1144501081_1144501083 -1 Left 1144501081 17:15786920-15786942 CCTCTGATTCCTTCAACGAGGAC No data
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144501081 Original CRISPR GTCCTCGTTGAAGGAATCAG AGG (reversed) Intergenic