ID: 1144501083

View in Genome Browser
Species Human (GRCh38)
Location 17:15786942-15786964
Sequence CAACACTGCCTTCGCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144501082_1144501083 -10 Left 1144501082 17:15786929-15786951 CCTTCAACGAGGACAACACTGCC No data
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data
1144501076_1144501083 22 Left 1144501076 17:15786897-15786919 CCCCCGCGGCGGCGACGTCTGCT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data
1144501081_1144501083 -1 Left 1144501081 17:15786920-15786942 CCTCTGATTCCTTCAACGAGGAC No data
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data
1144501079_1144501083 19 Left 1144501079 17:15786900-15786922 CCGCGGCGGCGACGTCTGCTCCT No data
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data
1144501077_1144501083 21 Left 1144501077 17:15786898-15786920 CCCCGCGGCGGCGACGTCTGCTC No data
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data
1144501078_1144501083 20 Left 1144501078 17:15786899-15786921 CCCGCGGCGGCGACGTCTGCTCC No data
Right 1144501083 17:15786942-15786964 CAACACTGCCTTCGCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144501083 Original CRISPR CAACACTGCCTTCGCCAAGC AGG Intergenic