ID: 1144508092

View in Genome Browser
Species Human (GRCh38)
Location 17:15850614-15850636
Sequence TCATTGGTATTTCGCTTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144508092_1144508104 27 Left 1144508092 17:15850614-15850636 CCCCCTAAGCGAAATACCAATGA 0: 1
1: 1
2: 0
3: 10
4: 63
Right 1144508104 17:15850664-15850686 CTGCCAGGTAGATGAGCCCCAGG No data
1144508092_1144508102 12 Left 1144508092 17:15850614-15850636 CCCCCTAAGCGAAATACCAATGA 0: 1
1: 1
2: 0
3: 10
4: 63
Right 1144508102 17:15850649-15850671 CAGCTGCTGTCTCTCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144508092 Original CRISPR TCATTGGTATTTCGCTTAGG GGG (reversed) Intergenic
902705541 1:18201644-18201666 TCCTTGCTATTTCCCTTAGAAGG - Intronic
903034288 1:20484752-20484774 TCATTGTTACTTGGCTTGGGAGG - Intronic
903544831 1:24117506-24117528 TTATTGATATTTCGCAAAGGAGG - Intergenic
910729455 1:90377138-90377160 TCATTAGTATTTTCCTCAGGAGG + Intergenic
918753405 1:188303616-188303638 TAACTGGTATTTGGCTTTGGGGG + Intergenic
919604970 1:199670324-199670346 TCATTGGTATTTCTCTGAAGTGG - Intergenic
1065543865 10:26798812-26798834 TCAATGGTATATCCCTTAAGTGG + Intronic
1066050791 10:31633078-31633100 TCATTGGTTTTTGGCTTTGTGGG - Intergenic
1066366953 10:34786456-34786478 TCCTTGTTATTTCTCTTATGGGG - Intronic
1067170274 10:43900243-43900265 TGACTGGTAGTTCCCTTAGGTGG + Intergenic
1072092579 10:92143257-92143279 GCAATGGTATTTCACTTAGTAGG - Intronic
1073593724 10:104779997-104780019 ACATTGCTATTTTGCTTATGGGG + Intronic
1078285919 11:9955235-9955257 TCATTGGTATCTCTCTTATCAGG + Intronic
1081885438 11:46491912-46491934 TCCTTGGCATTTAGCTTTGGGGG - Intronic
1088523085 11:110720319-110720341 TCATTGGTATTTAACTTTGAAGG + Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091354275 11:134923680-134923702 TCATTGCTACTTTGCTCAGGAGG - Intergenic
1100049836 12:90434811-90434833 TCATTGGTTTATCGGTTTGGAGG + Intergenic
1103174017 12:118845982-118846004 TTATTCCTATTTCGCTTATGAGG + Intergenic
1106487535 13:30185538-30185560 CCATTGGTGTTTAGCTTAAGGGG + Intergenic
1111952047 13:94716351-94716373 TCATTGGATTTTCACCTAGGTGG + Intergenic
1119026957 14:71160841-71160863 TCATTGGTATTTTGGTAGGGAGG - Intergenic
1119166622 14:72499996-72500018 TCATTGGTATTTGGGAAAGGAGG + Intronic
1124562833 15:30791521-30791543 TCACTGGGATTTCGCTGACGTGG + Intergenic
1125080358 15:35665425-35665447 TCATTGGTATTTCTGTTTTGTGG + Intergenic
1127831981 15:62758993-62759015 TCCGTGGTATTTTGCTAAGGGGG + Intronic
1129043855 15:72715290-72715312 GCATTGATATTTCGCCTAGAAGG + Exonic
1130260390 15:82349370-82349392 TCACTGGTATTTCGCTGATGTGG - Exonic
1130268339 15:82430063-82430085 TCACTGGTATTTCGCTGATGTGG + Exonic
1130280842 15:82519637-82519659 TCACTGGTATTTCGCTGATGTGG + Intergenic
1130472214 15:84235818-84235840 TCACTGGTATTTCGCTGATGTGG + Exonic
1130479706 15:84350389-84350411 TCACTGGTATTTCGCTGATGTGG + Intergenic
1130492064 15:84437740-84437762 TCACTGGTATTTCGCTGATGTGG - Intergenic
1130503681 15:84516780-84516802 TCACTGGTATTTCGCTGATGTGG - Intergenic
1130594511 15:85240455-85240477 TCACTGGTATTTCGCTGATGTGG + Intergenic
1135356845 16:21776015-21776037 TGATTTGTAATTGGCTTAGGAGG + Intergenic
1135455347 16:22592142-22592164 TGATTTGTAATTGGCTTAGGAGG + Intergenic
1143161114 17:4871966-4871988 TGATTTGTATTTCCCTCAGGAGG - Intronic
1144508092 17:15850614-15850636 TCATTGGTATTTCGCTTAGGGGG - Intergenic
1145172214 17:20668252-20668274 TCACTGGTATTTCGCTTAGGAGG - Intergenic
1150978288 17:70113199-70113221 TCCCTGGTATTTGGCTTGGGTGG - Intronic
1151567933 17:74910227-74910249 TAATTCGTACTTCCCTTAGGTGG - Intergenic
940440836 2:153714238-153714260 TCATTGCTTTTTCTCCTAGGAGG + Intergenic
941335506 2:164239553-164239575 TCATTGGTTTTCTGCTAAGGTGG - Intergenic
1181840466 22:25654817-25654839 GCATTGGTGTTTCTCTTAGCTGG + Intronic
1182570079 22:31230435-31230457 TCAAAGGTGTTTGGCTTAGGAGG + Intronic
950200901 3:11043051-11043073 TCCTTGCTATGTTGCTTAGGTGG - Intergenic
952452936 3:33448516-33448538 TAATTTGTACTTCCCTTAGGTGG - Intergenic
955876413 3:63494333-63494355 TCATTTGTATTTGGCTGAGGTGG - Intronic
962413169 3:135159344-135159366 TCATTGGTATTTGGATTGTGAGG - Intronic
962499143 3:135971630-135971652 TCATTGGTTTATCAGTTAGGTGG + Intronic
963479168 3:145847661-145847683 TCATTGGAATTTTGCATAAGAGG + Intergenic
964853281 3:161118187-161118209 TCATTGGCATTTTGATGAGGAGG - Intronic
971955294 4:33410126-33410148 TCATTTGTATTTCACTTACTTGG + Intergenic
975749401 4:77507529-77507551 TCATTGGTTTTTCTCTTCAGAGG + Intergenic
982400478 4:154961838-154961860 TCATTGGTACTATGCTTAGATGG + Intergenic
984612991 4:181862028-181862050 TGATTTGTATTTGGCTTGGGTGG + Intergenic
987906053 5:24078718-24078740 TCTGTGGTATTTCGTTAAGGAGG + Intronic
995399767 5:111727768-111727790 TCTTTGGTATTCCTTTTAGGAGG + Intronic
995967482 5:117925960-117925982 TCATTGGTATTTTGTGTATGTGG + Intergenic
997395344 5:133555453-133555475 TCATTGGTATTTGACAGAGGAGG - Intronic
1004986039 6:21083889-21083911 TCATTTTTATTTAGCTTAAGAGG - Intronic
1016342760 6:143080990-143081012 TCGTTGATATTTGGCTAAGGAGG + Intronic
1020480165 7:8649511-8649533 TCCTTAGTATTTCTCTTCGGTGG + Intronic
1023730053 7:43182703-43182725 TCATTGGTATTTTGATAGGGAGG + Intronic
1026365472 7:69644125-69644147 TCTTTGGTATTTCGTTATGGTGG + Intronic
1031471808 7:122175928-122175950 TTGTTGGTATTTGGCTAAGGAGG - Intergenic
1031731668 7:125309710-125309732 TAATTTGTACTTCCCTTAGGTGG - Intergenic
1041032771 8:53754967-53754989 TGACTGGCATTTTGCTTAGGGGG + Intronic
1052462236 9:28780308-28780330 TCATTGGTATTTAACGTAGAGGG + Intergenic
1187538364 X:20165057-20165079 TAATTTGTATTTCAATTAGGTGG - Exonic
1188853846 X:35167121-35167143 TCATTGGTATTTCCGTAGGGTGG + Intergenic
1202242768 Y:22788038-22788060 TCATTTGTACTTCCCTCAGGTGG - Intergenic
1202395755 Y:24421788-24421810 TCATTTGTACTTCCCTCAGGTGG - Intergenic
1202475030 Y:25248304-25248326 TCATTTGTACTTCCCTCAGGTGG + Intergenic