ID: 1144511481

View in Genome Browser
Species Human (GRCh38)
Location 17:15880876-15880898
Sequence GTAAGCAATCTTGCCCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144511481_1144511482 -7 Left 1144511481 17:15880876-15880898 CCTAATTGGGCAAGATTGCTTAC No data
Right 1144511482 17:15880892-15880914 TGCTTACCAGCTTGCGAAGTAGG No data
1144511481_1144511483 -6 Left 1144511481 17:15880876-15880898 CCTAATTGGGCAAGATTGCTTAC No data
Right 1144511483 17:15880893-15880915 GCTTACCAGCTTGCGAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144511481 Original CRISPR GTAAGCAATCTTGCCCAATT AGG (reversed) Intergenic
No off target data available for this crispr