ID: 1144511810

View in Genome Browser
Species Human (GRCh38)
Location 17:15883480-15883502
Sequence CTGTGGTTCTGGAGGAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144511804_1144511810 7 Left 1144511804 17:15883450-15883472 CCATGGTGGCAGGTGGTCTCTCA No data
Right 1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144511810 Original CRISPR CTGTGGTTCTGGAGGAGAGG AGG Intergenic
No off target data available for this crispr