ID: 1144515997

View in Genome Browser
Species Human (GRCh38)
Location 17:15917844-15917866
Sequence TTGGGGTGGCCTCCTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144515997_1144516004 4 Left 1144515997 17:15917844-15917866 CCTGCCACAGGAGGCCACCCCAA No data
Right 1144516004 17:15917871-15917893 CGCCTGTCCAGGCGAGTGCTCGG No data
1144515997_1144516000 -7 Left 1144515997 17:15917844-15917866 CCTGCCACAGGAGGCCACCCCAA No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515997_1144516005 5 Left 1144515997 17:15917844-15917866 CCTGCCACAGGAGGCCACCCCAA No data
Right 1144516005 17:15917872-15917894 GCCTGTCCAGGCGAGTGCTCGGG No data
1144515997_1144516007 10 Left 1144515997 17:15917844-15917866 CCTGCCACAGGAGGCCACCCCAA No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144515997 Original CRISPR TTGGGGTGGCCTCCTGTGGC AGG (reversed) Intergenic